FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641399_at:

>probe:Drosophila_2:1641399_at:715:243; Interrogation_Position=1017; Antisense; AATTTGCTTGCGTTTGCGTGTTACA
>probe:Drosophila_2:1641399_at:57:451; Interrogation_Position=481; Antisense; GATCGACTTGCGTCAGAGGACCAAT
>probe:Drosophila_2:1641399_at:280:111; Interrogation_Position=500; Antisense; ACCAATTTGCGCACCTTCGAAGGGA
>probe:Drosophila_2:1641399_at:271:79; Interrogation_Position=537; Antisense; AGGTATCGAGTTTCGTCTACGAGTA
>probe:Drosophila_2:1641399_at:53:667; Interrogation_Position=589; Antisense; TACACTCGACGAGTGGCGTGCCATG
>probe:Drosophila_2:1641399_at:309:575; Interrogation_Position=603; Antisense; GGCGTGCCATGCAGGCGCAGAAAAA
>probe:Drosophila_2:1641399_at:446:105; Interrogation_Position=694; Antisense; AGAAACTGTACGAGCCGAGGGATCA
>probe:Drosophila_2:1641399_at:564:453; Interrogation_Position=714; Antisense; GATCAGGAGACACAGACGACACCAA
>probe:Drosophila_2:1641399_at:30:101; Interrogation_Position=792; Antisense; AGAGGTCTGCTGGATCTGGAGAAAC
>probe:Drosophila_2:1641399_at:576:389; Interrogation_Position=818; Antisense; GAAACAGCCGCAGCATCTGGAGTAC
>probe:Drosophila_2:1641399_at:218:41; Interrogation_Position=832; Antisense; ATCTGGAGTACCTGACGCATCTGGA
>probe:Drosophila_2:1641399_at:239:325; Interrogation_Position=918; Antisense; GCGAAGAATTAACCGCTGACCGCCC
>probe:Drosophila_2:1641399_at:456:411; Interrogation_Position=935; Antisense; GACCGCCCGTTGTACGTTGTTGATA
>probe:Drosophila_2:1641399_at:459:533; Interrogation_Position=986; Antisense; GGTGTTATTCCTTATCGCTTAAAAT

Paste this into a BLAST search page for me
AATTTGCTTGCGTTTGCGTGTTACAGATCGACTTGCGTCAGAGGACCAATACCAATTTGCGCACCTTCGAAGGGAAGGTATCGAGTTTCGTCTACGAGTATACACTCGACGAGTGGCGTGCCATGGGCGTGCCATGCAGGCGCAGAAAAAAGAAACTGTACGAGCCGAGGGATCAGATCAGGAGACACAGACGACACCAAAGAGGTCTGCTGGATCTGGAGAAACGAAACAGCCGCAGCATCTGGAGTACATCTGGAGTACCTGACGCATCTGGAGCGAAGAATTAACCGCTGACCGCCCGACCGCCCGTTGTACGTTGTTGATAGGTGTTATTCCTTATCGCTTAAAAT

Full Affymetrix probeset data:

Annotations for 1641399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720