Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641400_at:

>probe:Drosophila_2:1641400_at:342:255; Interrogation_Position=3644; Antisense; CAACATGATCAAACCGCATCGGGCA
>probe:Drosophila_2:1641400_at:161:129; Interrogation_Position=3690; Antisense; ACCTCGGATGGTCACAGGTGCTCAA
>probe:Drosophila_2:1641400_at:190:81; Interrogation_Position=3705; Antisense; AGGTGCTCAAGCATCAGCACTCTGG
>probe:Drosophila_2:1641400_at:509:107; Interrogation_Position=3735; Antisense; AGAACTTCTCTCTATCGGATGACAT
>probe:Drosophila_2:1641400_at:384:531; Interrogation_Position=3767; Antisense; GGTGGAGCCGTGCATATTCCCCATT
>probe:Drosophila_2:1641400_at:696:465; Interrogation_Position=3813; Antisense; GATTGGAGACCTATCGCCAGCTAGC
>probe:Drosophila_2:1641400_at:441:77; Interrogation_Position=3845; Antisense; AGGATGCAAAGCTCCATGGGCGCCG
>probe:Drosophila_2:1641400_at:103:581; Interrogation_Position=3880; Antisense; GGCCAACACCATTGTGTCCCAGAGT
>probe:Drosophila_2:1641400_at:489:253; Interrogation_Position=3943; Antisense; CACACGGGATCTGCGCAACTGGCTG
>probe:Drosophila_2:1641400_at:501:137; Interrogation_Position=3987; Antisense; ACGATTTTCTCGTTCAGCACGGCAT
>probe:Drosophila_2:1641400_at:208:113; Interrogation_Position=4002; Antisense; AGCACGGCATTCCATCGGGACAGAC
>probe:Drosophila_2:1641400_at:321:475; Interrogation_Position=4088; Antisense; GTTAGTGCTTCTTTGAACAGCGGCA
>probe:Drosophila_2:1641400_at:49:263; Interrogation_Position=4105; Antisense; CAGCGGCAGTGCATCTATTATCAAT
>probe:Drosophila_2:1641400_at:392:27; Interrogation_Position=4128; Antisense; ATACTACGACTACTGCTGGAAGCTC

Paste this into a BLAST search page for me
CAACATGATCAAACCGCATCGGGCAACCTCGGATGGTCACAGGTGCTCAAAGGTGCTCAAGCATCAGCACTCTGGAGAACTTCTCTCTATCGGATGACATGGTGGAGCCGTGCATATTCCCCATTGATTGGAGACCTATCGCCAGCTAGCAGGATGCAAAGCTCCATGGGCGCCGGGCCAACACCATTGTGTCCCAGAGTCACACGGGATCTGCGCAACTGGCTGACGATTTTCTCGTTCAGCACGGCATAGCACGGCATTCCATCGGGACAGACGTTAGTGCTTCTTTGAACAGCGGCACAGCGGCAGTGCATCTATTATCAATATACTACGACTACTGCTGGAAGCTC

Full Affymetrix probeset data:

Annotations for 1641400_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime