FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641403_at:

>probe:Drosophila_2:1641403_at:704:73; Interrogation_Position=6524; Antisense; AGGACATCACAGACTACTCACTAGT
>probe:Drosophila_2:1641403_at:130:651; Interrogation_Position=6541; Antisense; TCACTAGTCATACCTACGCTGGAGT
>probe:Drosophila_2:1641403_at:714:573; Interrogation_Position=6587; Antisense; GGCTGGATTTGCTTCTGGCCATGAA
>probe:Drosophila_2:1641403_at:267:531; Interrogation_Position=6626; Antisense; GGGTGATATTCTCGCAGGCCATCAA
>probe:Drosophila_2:1641403_at:76:109; Interrogation_Position=6653; Antisense; AGAAGCTACATATCCACCAGCGGCA
>probe:Drosophila_2:1641403_at:531:201; Interrogation_Position=6677; Antisense; AACCGATTCTATCCGCAGGCGAACG
>probe:Drosophila_2:1641403_at:102:533; Interrogation_Position=6783; Antisense; GGGTGTGTTCAAGTTTGCCTCGAGC
>probe:Drosophila_2:1641403_at:17:425; Interrogation_Position=6830; Antisense; GAGACGCTTGTGTTCTTTCAACGAT
>probe:Drosophila_2:1641403_at:449:509; Interrogation_Position=6907; Antisense; GTGCAACTTGCGGTACTGACCAGGA
>probe:Drosophila_2:1641403_at:257:143; Interrogation_Position=6921; Antisense; ACTGACCAGGACTTAGCACTGCTTA
>probe:Drosophila_2:1641403_at:556:355; Interrogation_Position=6936; Antisense; GCACTGCTTATCTAAAACGCCGTAA
>probe:Drosophila_2:1641403_at:33:33; Interrogation_Position=6971; Antisense; ATAATGTCTAGTGCGTCTTGGCCCA
>probe:Drosophila_2:1641403_at:161:241; Interrogation_Position=7014; Antisense; AATACAATCACACACACTCTCAAGT
>probe:Drosophila_2:1641403_at:505:91; Interrogation_Position=7036; Antisense; AGTATTACGCTATGCAACTCTCTAA

Paste this into a BLAST search page for me
AGGACATCACAGACTACTCACTAGTTCACTAGTCATACCTACGCTGGAGTGGCTGGATTTGCTTCTGGCCATGAAGGGTGATATTCTCGCAGGCCATCAAAGAAGCTACATATCCACCAGCGGCAAACCGATTCTATCCGCAGGCGAACGGGGTGTGTTCAAGTTTGCCTCGAGCGAGACGCTTGTGTTCTTTCAACGATGTGCAACTTGCGGTACTGACCAGGAACTGACCAGGACTTAGCACTGCTTAGCACTGCTTATCTAAAACGCCGTAAATAATGTCTAGTGCGTCTTGGCCCAAATACAATCACACACACTCTCAAGTAGTATTACGCTATGCAACTCTCTAA

Full Affymetrix probeset data:

Annotations for 1641403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720