FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641406_at:

>probe:Drosophila_2:1641406_at:366:547; Interrogation_Position=1237; Antisense; GGAGTGACCGTCGTAGTGGATCATA
>probe:Drosophila_2:1641406_at:466:83; Interrogation_Position=1251; Antisense; AGTGGATCATACAACTCGGCAGTTT
>probe:Drosophila_2:1641406_at:539:557; Interrogation_Position=1376; Antisense; GGAAATTTGCCTTTGTGGCTAATTC
>probe:Drosophila_2:1641406_at:99:571; Interrogation_Position=1392; Antisense; GGCTAATTCAATTCCTTGGCGTACT
>probe:Drosophila_2:1641406_at:568:413; Interrogation_Position=1473; Antisense; GACCATTCTTGAGAACGTGCCGCTA
>probe:Drosophila_2:1641406_at:512:303; Interrogation_Position=1492; Antisense; CCGCTAACTTTCTCGATACGCAGAA
>probe:Drosophila_2:1641406_at:325:395; Interrogation_Position=1514; Antisense; GAAATGCGATATTTAGCCATCACCT
>probe:Drosophila_2:1641406_at:292:125; Interrogation_Position=1528; Antisense; AGCCATCACCTACGCAATTTTATTA
>probe:Drosophila_2:1641406_at:374:463; Interrogation_Position=1564; Antisense; GATTCGGGTATGATCACTTGCTGGT
>probe:Drosophila_2:1641406_at:679:509; Interrogation_Position=1637; Antisense; GTGAATCTGAGCAGCAGCCGTCTCA
>probe:Drosophila_2:1641406_at:84:499; Interrogation_Position=1656; Antisense; GTCTCATCTTCCACTGTCATTTGAT
>probe:Drosophila_2:1641406_at:708:709; Interrogation_Position=1684; Antisense; TTCAAATGGCTGTGGGCTGTACTTT
>probe:Drosophila_2:1641406_at:99:595; Interrogation_Position=1696; Antisense; TGGGCTGTACTTTGCATTGCCTACG
>probe:Drosophila_2:1641406_at:68:275; Interrogation_Position=1710; Antisense; CATTGCCTACGTCATGTCATTCATG

Paste this into a BLAST search page for me
GGAGTGACCGTCGTAGTGGATCATAAGTGGATCATACAACTCGGCAGTTTGGAAATTTGCCTTTGTGGCTAATTCGGCTAATTCAATTCCTTGGCGTACTGACCATTCTTGAGAACGTGCCGCTACCGCTAACTTTCTCGATACGCAGAAGAAATGCGATATTTAGCCATCACCTAGCCATCACCTACGCAATTTTATTAGATTCGGGTATGATCACTTGCTGGTGTGAATCTGAGCAGCAGCCGTCTCAGTCTCATCTTCCACTGTCATTTGATTTCAAATGGCTGTGGGCTGTACTTTTGGGCTGTACTTTGCATTGCCTACGCATTGCCTACGTCATGTCATTCATG

Full Affymetrix probeset data:

Annotations for 1641406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720