FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641409_at:

>probe:Drosophila_2:1641409_at:552:653; Interrogation_Position=105; Antisense; TAGTTCCGGTAGCATTTCCCCGGTG
>probe:Drosophila_2:1641409_at:338:37; Interrogation_Position=142; Antisense; ATCATCTCCATCAGTCACGATGGCG
>probe:Drosophila_2:1641409_at:540:565; Interrogation_Position=15; Antisense; GGCACACTTAAAACTGGACACCCTC
>probe:Drosophila_2:1641409_at:671:33; Interrogation_Position=151; Antisense; ATCAGTCACGATGGCGACGAGTCCG
>probe:Drosophila_2:1641409_at:89:495; Interrogation_Position=155; Antisense; GTCACGATGGCGACGAGTCCGAGTC
>probe:Drosophila_2:1641409_at:524:83; Interrogation_Position=170; Antisense; AGTCCGAGTCGGAGTCGGAAATCGA
>probe:Drosophila_2:1641409_at:198:559; Interrogation_Position=186; Antisense; GGAAATCGAAACTGAGCCGGCGCGC
>probe:Drosophila_2:1641409_at:400:165; Interrogation_Position=188; Antisense; AAATCGAAACTGAGCCGGCGCGCCT
>probe:Drosophila_2:1641409_at:633:219; Interrogation_Position=235; Antisense; AAGTGCACCAACAACCTGGTAAGTT
>probe:Drosophila_2:1641409_at:7:253; Interrogation_Position=246; Antisense; CAACCTGGTAAGTTCAAAGATCTAG
>probe:Drosophila_2:1641409_at:38:587; Interrogation_Position=29; Antisense; TGGACACCCTCCACGTGCAGCGAAG
>probe:Drosophila_2:1641409_at:625:209; Interrogation_Position=90; Antisense; AAGAAGCAGTGCCTGTAGTTCCGGT
>probe:Drosophila_2:1641409_at:469:207; Interrogation_Position=93; Antisense; AAGCAGTGCCTGTAGTTCCGGTAGC
>probe:Drosophila_2:1641409_at:341:505; Interrogation_Position=98; Antisense; GTGCCTGTAGTTCCGGTAGCATTTC

Paste this into a BLAST search page for me
TAGTTCCGGTAGCATTTCCCCGGTGATCATCTCCATCAGTCACGATGGCGGGCACACTTAAAACTGGACACCCTCATCAGTCACGATGGCGACGAGTCCGGTCACGATGGCGACGAGTCCGAGTCAGTCCGAGTCGGAGTCGGAAATCGAGGAAATCGAAACTGAGCCGGCGCGCAAATCGAAACTGAGCCGGCGCGCCTAAGTGCACCAACAACCTGGTAAGTTCAACCTGGTAAGTTCAAAGATCTAGTGGACACCCTCCACGTGCAGCGAAGAAGAAGCAGTGCCTGTAGTTCCGGTAAGCAGTGCCTGTAGTTCCGGTAGCGTGCCTGTAGTTCCGGTAGCATTTC

Full Affymetrix probeset data:

Annotations for 1641409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720