FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641411_at:

>probe:Drosophila_2:1641411_at:338:153; Interrogation_Position=1046; Antisense; ACATGGATCGGGATCATCGCCTGGT
>probe:Drosophila_2:1641411_at:441:647; Interrogation_Position=1059; Antisense; TCATCGCCTGGTCAATGGAAATGCA
>probe:Drosophila_2:1641411_at:295:233; Interrogation_Position=1078; Antisense; AATGCAGATCCCAACGAAAGCTGGC
>probe:Drosophila_2:1641411_at:676:391; Interrogation_Position=1093; Antisense; GAAAGCTGGCAGCATCTGCGCGTTA
>probe:Drosophila_2:1641411_at:641:619; Interrogation_Position=1109; Antisense; TGCGCGTTACGACCGAAACTTTGGC
>probe:Drosophila_2:1641411_at:350:353; Interrogation_Position=1176; Antisense; GCACCAGATGCACAATACGAACCAA
>probe:Drosophila_2:1641411_at:530:363; Interrogation_Position=1206; Antisense; GAATTCGGATGTCAATGTCTACAGG
>probe:Drosophila_2:1641411_at:39:597; Interrogation_Position=1221; Antisense; TGTCTACAGGGAGCACCAGCTGGAC
>probe:Drosophila_2:1641411_at:435:207; Interrogation_Position=1252; Antisense; AAGCTGGAGCGCAGCTACACGCTGG
>probe:Drosophila_2:1641411_at:115:157; Interrogation_Position=1268; Antisense; ACACGCTGGCCGTGGAGTCGCGTCA
>probe:Drosophila_2:1641411_at:186:503; Interrogation_Position=1284; Antisense; GTCGCGTCACGGCATCATTGAGTAC
>probe:Drosophila_2:1641411_at:580:213; Interrogation_Position=879; Antisense; AAGAGAACACCTGTTGCTGGAGCAA
>probe:Drosophila_2:1641411_at:110:83; Interrogation_Position=940; Antisense; AGGGACAACCACCTCAGCCATTTGG
>probe:Drosophila_2:1641411_at:690:119; Interrogation_Position=989; Antisense; AGCGGAAGCGACACGTTTACGGCGA

Paste this into a BLAST search page for me
ACATGGATCGGGATCATCGCCTGGTTCATCGCCTGGTCAATGGAAATGCAAATGCAGATCCCAACGAAAGCTGGCGAAAGCTGGCAGCATCTGCGCGTTATGCGCGTTACGACCGAAACTTTGGCGCACCAGATGCACAATACGAACCAAGAATTCGGATGTCAATGTCTACAGGTGTCTACAGGGAGCACCAGCTGGACAAGCTGGAGCGCAGCTACACGCTGGACACGCTGGCCGTGGAGTCGCGTCAGTCGCGTCACGGCATCATTGAGTACAAGAGAACACCTGTTGCTGGAGCAAAGGGACAACCACCTCAGCCATTTGGAGCGGAAGCGACACGTTTACGGCGA

Full Affymetrix probeset data:

Annotations for 1641411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720