Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641412_at:

>probe:Drosophila_2:1641412_at:515:649; Interrogation_Position=593; Antisense; TACAGTACGCCCTCATGAAGTTGTT
>probe:Drosophila_2:1641412_at:178:267; Interrogation_Position=595; Antisense; CAGTACGCCCTCATGAAGTTGTTTC
>probe:Drosophila_2:1641412_at:12:89; Interrogation_Position=596; Antisense; AGTACGCCCTCATGAAGTTGTTTCC
>probe:Drosophila_2:1641412_at:129:673; Interrogation_Position=598; Antisense; TACGCCCTCATGAAGTTGTTTCCCA
>probe:Drosophila_2:1641412_at:185:321; Interrogation_Position=601; Antisense; GCCCTCATGAAGTTGTTTCCCATGG
>probe:Drosophila_2:1641412_at:296:55; Interrogation_Position=607; Antisense; ATGAAGTTGTTTCCCATGGAGATTC
>probe:Drosophila_2:1641412_at:534:189; Interrogation_Position=610; Antisense; AAGTTGTTTCCCATGGAGATTCGTA
>probe:Drosophila_2:1641412_at:36:469; Interrogation_Position=612; Antisense; GTTGTTTCCCATGGAGATTCGTACT
>probe:Drosophila_2:1641412_at:413:593; Interrogation_Position=614; Antisense; TGTTTCCCATGGAGATTCGTACTTA
>probe:Drosophila_2:1641412_at:401:307; Interrogation_Position=620; Antisense; CCATGGAGATTCGTACTTACTTTGT
>probe:Drosophila_2:1641412_at:432:549; Interrogation_Position=624; Antisense; GGAGATTCGTACTTACTTTGTATAC
>probe:Drosophila_2:1641412_at:296:463; Interrogation_Position=627; Antisense; GATTCGTACTTACTTTGTATACCAA
>probe:Drosophila_2:1641412_at:707:691; Interrogation_Position=640; Antisense; TTTGTATACCAACTCTTTAAGCGAA
>probe:Drosophila_2:1641412_at:53:597; Interrogation_Position=642; Antisense; TGTATACCAACTCTTTAAGCGAATG

Paste this into a BLAST search page for me
TACAGTACGCCCTCATGAAGTTGTTCAGTACGCCCTCATGAAGTTGTTTCAGTACGCCCTCATGAAGTTGTTTCCTACGCCCTCATGAAGTTGTTTCCCAGCCCTCATGAAGTTGTTTCCCATGGATGAAGTTGTTTCCCATGGAGATTCAAGTTGTTTCCCATGGAGATTCGTAGTTGTTTCCCATGGAGATTCGTACTTGTTTCCCATGGAGATTCGTACTTACCATGGAGATTCGTACTTACTTTGTGGAGATTCGTACTTACTTTGTATACGATTCGTACTTACTTTGTATACCAATTTGTATACCAACTCTTTAAGCGAATGTATACCAACTCTTTAAGCGAATG

Full Affymetrix probeset data:

Annotations for 1641412_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime