FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641418_at:

>probe:Drosophila_2:1641418_at:431:569; Interrogation_Position=1345; Antisense; GGCAGGCGAACTTCCGCAATCTATA
>probe:Drosophila_2:1641418_at:31:387; Interrogation_Position=1384; Antisense; GAAAATCGACCCTGAAGAAACTAGT
>probe:Drosophila_2:1641418_at:512:389; Interrogation_Position=1400; Antisense; GAAACTAGTCGCTGTAAGAACTCCA
>probe:Drosophila_2:1641418_at:473:493; Interrogation_Position=1413; Antisense; GTAAGAACTCCAATGGGCCACTTCT
>probe:Drosophila_2:1641418_at:116:595; Interrogation_Position=1426; Antisense; TGGGCCACTTCTCGGAAAACGTTTG
>probe:Drosophila_2:1641418_at:154:661; Interrogation_Position=1471; Antisense; TAGACCATTCAAACTTCGGCGGACT
>probe:Drosophila_2:1641418_at:589:165; Interrogation_Position=1552; Antisense; AAAGTTGGTAGATGAATCCCCGCCA
>probe:Drosophila_2:1641418_at:48:47; Interrogation_Position=1567; Antisense; ATCCCCGCCAAATTCGTCGGATGAA
>probe:Drosophila_2:1641418_at:585:213; Interrogation_Position=1590; Antisense; AAGAGTGCTTTTCCGATGATTTCCC
>probe:Drosophila_2:1641418_at:91:461; Interrogation_Position=1607; Antisense; GATTTCCCAGATGTTAGTCATTTCA
>probe:Drosophila_2:1641418_at:534:655; Interrogation_Position=1678; Antisense; TAACGTTATTAAGATCCTCCAAAGG
>probe:Drosophila_2:1641418_at:387:451; Interrogation_Position=1702; Antisense; GATCGAGCAAAATTGGTACCGCAGT
>probe:Drosophila_2:1641418_at:432:665; Interrogation_Position=1842; Antisense; TACGTTTTCGGCCAAGTTGTTCACT
>probe:Drosophila_2:1641418_at:588:243; Interrogation_Position=1869; Antisense; AATTCCGTAAATCAGCTCGAACAAA

Paste this into a BLAST search page for me
GGCAGGCGAACTTCCGCAATCTATAGAAAATCGACCCTGAAGAAACTAGTGAAACTAGTCGCTGTAAGAACTCCAGTAAGAACTCCAATGGGCCACTTCTTGGGCCACTTCTCGGAAAACGTTTGTAGACCATTCAAACTTCGGCGGACTAAAGTTGGTAGATGAATCCCCGCCAATCCCCGCCAAATTCGTCGGATGAAAAGAGTGCTTTTCCGATGATTTCCCGATTTCCCAGATGTTAGTCATTTCATAACGTTATTAAGATCCTCCAAAGGGATCGAGCAAAATTGGTACCGCAGTTACGTTTTCGGCCAAGTTGTTCACTAATTCCGTAAATCAGCTCGAACAAA

Full Affymetrix probeset data:

Annotations for 1641418_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720