FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641419_at:

>probe:Drosophila_2:1641419_at:384:261; Interrogation_Position=328; Antisense; CACCCTGGGCTACAACAATCATGGA
>probe:Drosophila_2:1641419_at:399:67; Interrogation_Position=348; Antisense; ATGGACACGGCCTGGAACTGACCAA
>probe:Drosophila_2:1641419_at:130:291; Interrogation_Position=385; Antisense; CGGTGTGCGGGATAGCTTCCAGCAA
>probe:Drosophila_2:1641419_at:75:227; Interrogation_Position=458; Antisense; AAGGCATTTGCCTCGCAGAATCAGC
>probe:Drosophila_2:1641419_at:225:351; Interrogation_Position=472; Antisense; GCAGAATCAGCTTGCCAATGGCTTC
>probe:Drosophila_2:1641419_at:76:231; Interrogation_Position=509; Antisense; AATGAAGCTGCACTGGACTACTCCC
>probe:Drosophila_2:1641419_at:480:403; Interrogation_Position=524; Antisense; GACTACTCCCACATCAAAGGTCATG
>probe:Drosophila_2:1641419_at:496:221; Interrogation_Position=540; Antisense; AAGGTCATGGAGCTACCCTGACGCA
>probe:Drosophila_2:1641419_at:177:611; Interrogation_Position=558; Antisense; TGACGCACGCCAATATTCCCGGATT
>probe:Drosophila_2:1641419_at:217:239; Interrogation_Position=614; Antisense; AATCTTTGGCAGTCGCAGGATCGCA
>probe:Drosophila_2:1641419_at:647:677; Interrogation_Position=648; Antisense; TAGATCTGGGCAGCACGGCATCCAA
>probe:Drosophila_2:1641419_at:363:519; Interrogation_Position=673; Antisense; GTGGACAAGTGGACCCTTCAAGGGC
>probe:Drosophila_2:1641419_at:54:413; Interrogation_Position=700; Antisense; GACCGATCTGGGTGCCAATCTGGGA
>probe:Drosophila_2:1641419_at:578:557; Interrogation_Position=722; Antisense; GGACTCTCGCACTACTTTGGATAAA

Paste this into a BLAST search page for me
CACCCTGGGCTACAACAATCATGGAATGGACACGGCCTGGAACTGACCAACGGTGTGCGGGATAGCTTCCAGCAAAAGGCATTTGCCTCGCAGAATCAGCGCAGAATCAGCTTGCCAATGGCTTCAATGAAGCTGCACTGGACTACTCCCGACTACTCCCACATCAAAGGTCATGAAGGTCATGGAGCTACCCTGACGCATGACGCACGCCAATATTCCCGGATTAATCTTTGGCAGTCGCAGGATCGCATAGATCTGGGCAGCACGGCATCCAAGTGGACAAGTGGACCCTTCAAGGGCGACCGATCTGGGTGCCAATCTGGGAGGACTCTCGCACTACTTTGGATAAA

Full Affymetrix probeset data:

Annotations for 1641419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720