Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641422_at:

>probe:Drosophila_2:1641422_at:630:61; Interrogation_Position=10996; Antisense; AGGCGGCTAAACTTGCTGCAAAGAC
>probe:Drosophila_2:1641422_at:312:193; Interrogation_Position=11037; Antisense; AACTAATTGCCCCAAGCTGCGGAGA
>probe:Drosophila_2:1641422_at:410:89; Interrogation_Position=11063; Antisense; AGTTTAAGCGGATGTCCCTCTTCCT
>probe:Drosophila_2:1641422_at:39:645; Interrogation_Position=11081; Antisense; TCTTCCTTGCGTTTGTACTACTTCA
>probe:Drosophila_2:1641422_at:680:701; Interrogation_Position=11211; Antisense; TTATTGCAAACGAATGTCCGCCACC
>probe:Drosophila_2:1641422_at:508:301; Interrogation_Position=11240; Antisense; CCCGCAATTCCTAATCTGGTCGAAA
>probe:Drosophila_2:1641422_at:463:113; Interrogation_Position=11278; Antisense; AGCAGCGAGCGACCCGCAATTAATT
>probe:Drosophila_2:1641422_at:653:361; Interrogation_Position=11293; Antisense; GCAATTAATTCCTGCGGCTTTCGAC
>probe:Drosophila_2:1641422_at:620:591; Interrogation_Position=11305; Antisense; TGCGGCTTTCGACAAGGACCCAGAA
>probe:Drosophila_2:1641422_at:669:59; Interrogation_Position=11340; Antisense; ATGTTCTTCTCAGTTTTCGGCTAAA
>probe:Drosophila_2:1641422_at:454:703; Interrogation_Position=11374; Antisense; TTATTTATTATGACGCTGCCTGCTG
>probe:Drosophila_2:1641422_at:525:363; Interrogation_Position=11410; Antisense; GAATACCGGCCGAAGGACGCTAGTG
>probe:Drosophila_2:1641422_at:324:15; Interrogation_Position=11438; Antisense; ATTAGTATGCGCCTTAGCCAATTGC
>probe:Drosophila_2:1641422_at:193:247; Interrogation_Position=11457; Antisense; AATTGCCGGCTAATTCCCAATCAAA

Paste this into a BLAST search page for me
AGGCGGCTAAACTTGCTGCAAAGACAACTAATTGCCCCAAGCTGCGGAGAAGTTTAAGCGGATGTCCCTCTTCCTTCTTCCTTGCGTTTGTACTACTTCATTATTGCAAACGAATGTCCGCCACCCCCGCAATTCCTAATCTGGTCGAAAAGCAGCGAGCGACCCGCAATTAATTGCAATTAATTCCTGCGGCTTTCGACTGCGGCTTTCGACAAGGACCCAGAAATGTTCTTCTCAGTTTTCGGCTAAATTATTTATTATGACGCTGCCTGCTGGAATACCGGCCGAAGGACGCTAGTGATTAGTATGCGCCTTAGCCAATTGCAATTGCCGGCTAATTCCCAATCAAA

Full Affymetrix probeset data:

Annotations for 1641422_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime