FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641423_at:

>probe:Drosophila_2:1641423_at:646:81; Interrogation_Position=2202; Antisense; AGAGCCCAATCCCTACGAAGTGGTA
>probe:Drosophila_2:1641423_at:123:293; Interrogation_Position=2217; Antisense; CGAAGTGGTAACATCCCTAGGAGGA
>probe:Drosophila_2:1641423_at:216:623; Interrogation_Position=2247; Antisense; TCCCCAAGAGCTTCGTTGTGTTAGT
>probe:Drosophila_2:1641423_at:302:519; Interrogation_Position=2270; Antisense; GTGGCAAGTGCATCACTGTCAGTCA
>probe:Drosophila_2:1641423_at:16:257; Interrogation_Position=2308; Antisense; CAAATTGATTGTCCCGATGCTGCCG
>probe:Drosophila_2:1641423_at:252:337; Interrogation_Position=2326; Antisense; GCTGCCGACGAACTAATGTGCGTTT
>probe:Drosophila_2:1641423_at:557:225; Interrogation_Position=2340; Antisense; AATGTGCGTTTATCGGGAGCGCCCA
>probe:Drosophila_2:1641423_at:149:309; Interrogation_Position=2444; Antisense; CCACGGGTCCGTTGAGCAGTACAAG
>probe:Drosophila_2:1641423_at:88:491; Interrogation_Position=2462; Antisense; GTACAAGGCGTTCGTTGAGGACCAC
>probe:Drosophila_2:1641423_at:281:415; Interrogation_Position=2481; Antisense; GACCACGCCCAATCGAAGTCGAAAG
>probe:Drosophila_2:1641423_at:611:61; Interrogation_Position=2548; Antisense; ATGTCTCTATTATTTCTCTCCACTT
>probe:Drosophila_2:1641423_at:211:19; Interrogation_Position=2559; Antisense; ATTTCTCTCCACTTGTATTTTCTTC
>probe:Drosophila_2:1641423_at:38:483; Interrogation_Position=2573; Antisense; GTATTTTCTTCGCTCGCTATATGTA
>probe:Drosophila_2:1641423_at:36:481; Interrogation_Position=2657; Antisense; GTTTGACTATTTGTATGCGCGTGAA

Paste this into a BLAST search page for me
AGAGCCCAATCCCTACGAAGTGGTACGAAGTGGTAACATCCCTAGGAGGATCCCCAAGAGCTTCGTTGTGTTAGTGTGGCAAGTGCATCACTGTCAGTCACAAATTGATTGTCCCGATGCTGCCGGCTGCCGACGAACTAATGTGCGTTTAATGTGCGTTTATCGGGAGCGCCCACCACGGGTCCGTTGAGCAGTACAAGGTACAAGGCGTTCGTTGAGGACCACGACCACGCCCAATCGAAGTCGAAAGATGTCTCTATTATTTCTCTCCACTTATTTCTCTCCACTTGTATTTTCTTCGTATTTTCTTCGCTCGCTATATGTAGTTTGACTATTTGTATGCGCGTGAA

Full Affymetrix probeset data:

Annotations for 1641423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720