FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641424_at:

>probe:Drosophila_2:1641424_at:441:551; Interrogation_Position=1147; Antisense; GGAGACCTCGAAATCGCTGGCGGAC
>probe:Drosophila_2:1641424_at:476:555; Interrogation_Position=1168; Antisense; GGACCTGCGCAAGTACGTCAACAGT
>probe:Drosophila_2:1641424_at:532:439; Interrogation_Position=1216; Antisense; GATGGGCAAACTGCGTGATCCTTTG
>probe:Drosophila_2:1641424_at:367:587; Interrogation_Position=1261; Antisense; TGGAGCACCGCATCTGGACGACGAA
>probe:Drosophila_2:1641424_at:277:375; Interrogation_Position=1283; Antisense; GAAGAGATCGAGGACCACTCGCGCA
>probe:Drosophila_2:1641424_at:227:325; Interrogation_Position=1303; Antisense; GCGCACCATCGAGGAGTCCATGGAT
>probe:Drosophila_2:1641424_at:171:635; Interrogation_Position=1400; Antisense; TCGCAGTTCCGCTATCAACAGGCCG
>probe:Drosophila_2:1641424_at:329:519; Interrogation_Position=1496; Antisense; GTGGACCTTCGGCAAGTAGTACAAT
>probe:Drosophila_2:1641424_at:176:3; Interrogation_Position=1519; Antisense; ATAACGGACGAACAGCTCAACCACA
>probe:Drosophila_2:1641424_at:320:525; Interrogation_Position=1546; Antisense; GGGAACCACTGATTAGGCTTAATTG
>probe:Drosophila_2:1641424_at:481:569; Interrogation_Position=1561; Antisense; GGCTTAATTGAAACCATTGACCACC
>probe:Drosophila_2:1641424_at:177:7; Interrogation_Position=1576; Antisense; ATTGACCACCACGTTCTATGCTGTA
>probe:Drosophila_2:1641424_at:246:473; Interrogation_Position=1588; Antisense; GTTCTATGCTGTACCGTTCTGTAAA
>probe:Drosophila_2:1641424_at:612:481; Interrogation_Position=1645; Antisense; GTATAATCACTTGCAGACTGAACGG

Paste this into a BLAST search page for me
GGAGACCTCGAAATCGCTGGCGGACGGACCTGCGCAAGTACGTCAACAGTGATGGGCAAACTGCGTGATCCTTTGTGGAGCACCGCATCTGGACGACGAAGAAGAGATCGAGGACCACTCGCGCAGCGCACCATCGAGGAGTCCATGGATTCGCAGTTCCGCTATCAACAGGCCGGTGGACCTTCGGCAAGTAGTACAATATAACGGACGAACAGCTCAACCACAGGGAACCACTGATTAGGCTTAATTGGGCTTAATTGAAACCATTGACCACCATTGACCACCACGTTCTATGCTGTAGTTCTATGCTGTACCGTTCTGTAAAGTATAATCACTTGCAGACTGAACGG

Full Affymetrix probeset data:

Annotations for 1641424_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720