FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641426_at:

>probe:Drosophila_2:1641426_at:254:27; Interrogation_Position=1044; Antisense; ATAGCTGGCATCACGCAACACGAAA
>probe:Drosophila_2:1641426_at:494:401; Interrogation_Position=1071; Antisense; GACATTGTGACACCTAGTGACACCT
>probe:Drosophila_2:1641426_at:713:275; Interrogation_Position=1084; Antisense; CTAGTGACACCTCCTTGTTAGTGAG
>probe:Drosophila_2:1641426_at:172:183; Interrogation_Position=1120; Antisense; AAAAGGCCAGGCTTGCGATGAATCA
>probe:Drosophila_2:1641426_at:108:523; Interrogation_Position=586; Antisense; GGGCCCTTTGCGAGTTTCAGAGAGC
>probe:Drosophila_2:1641426_at:332:425; Interrogation_Position=605; Antisense; GAGAGCCTACAATATCGTCAATCAG
>probe:Drosophila_2:1641426_at:560:691; Interrogation_Position=641; Antisense; TTTGAGCAATTTATACCTGGACATG
>probe:Drosophila_2:1641426_at:118:419; Interrogation_Position=681; Antisense; GAGCTAGATCAACGCGTAGCCAGGT
>probe:Drosophila_2:1641426_at:696:665; Interrogation_Position=697; Antisense; TAGCCAGGTTGGACCGGTCTTTAGG
>probe:Drosophila_2:1641426_at:174:173; Interrogation_Position=735; Antisense; AAAGAGCTAGATTCGGTGCTGCAAA
>probe:Drosophila_2:1641426_at:135:363; Interrogation_Position=768; Antisense; GACTTAAACACGTATTTCTTTGGCG
>probe:Drosophila_2:1641426_at:265:405; Interrogation_Position=881; Antisense; GACGGACTTCCGGACTTTTATGAGT
>probe:Drosophila_2:1641426_at:10:109; Interrogation_Position=916; Antisense; AGAACTGCACCTGCAAGCGTTGCGA
>probe:Drosophila_2:1641426_at:262:105; Interrogation_Position=943; Antisense; AGAAGGATCCCTTGAAGCCGTACCT

Paste this into a BLAST search page for me
ATAGCTGGCATCACGCAACACGAAAGACATTGTGACACCTAGTGACACCTCTAGTGACACCTCCTTGTTAGTGAGAAAAGGCCAGGCTTGCGATGAATCAGGGCCCTTTGCGAGTTTCAGAGAGCGAGAGCCTACAATATCGTCAATCAGTTTGAGCAATTTATACCTGGACATGGAGCTAGATCAACGCGTAGCCAGGTTAGCCAGGTTGGACCGGTCTTTAGGAAAGAGCTAGATTCGGTGCTGCAAAGACTTAAACACGTATTTCTTTGGCGGACGGACTTCCGGACTTTTATGAGTAGAACTGCACCTGCAAGCGTTGCGAAGAAGGATCCCTTGAAGCCGTACCT

Full Affymetrix probeset data:

Annotations for 1641426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720