FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641427_at:

>probe:Drosophila_2:1641427_at:682:15; Interrogation_Position=3049; Antisense; ATTTTCGTTCCTAATTTTGCTATTG
>probe:Drosophila_2:1641427_at:102:243; Interrogation_Position=3061; Antisense; AATTTTGCTATTGAACTGCGTTCGA
>probe:Drosophila_2:1641427_at:325:383; Interrogation_Position=3073; Antisense; GAACTGCGTTCGAATCCATTTCACA
>probe:Drosophila_2:1641427_at:30:295; Interrogation_Position=3083; Antisense; CGAATCCATTTCACACCCAATTTAA
>probe:Drosophila_2:1641427_at:104:271; Interrogation_Position=3175; Antisense; CATGCCGTGATGCTGTCAAATGAGA
>probe:Drosophila_2:1641427_at:44:449; Interrogation_Position=3231; Antisense; GATCCCACAATCCTCTAATTACTGA
>probe:Drosophila_2:1641427_at:230:691; Interrogation_Position=3352; Antisense; TTTGTAGTCTAGAGTGCGCACGTTT
>probe:Drosophila_2:1641427_at:508:355; Interrogation_Position=3369; Antisense; GCACGTTTACTTTATGCGAGTTTAA
>probe:Drosophila_2:1641427_at:327:31; Interrogation_Position=3409; Antisense; ATAAAGGTATGTCCACCGCTGTTAT
>probe:Drosophila_2:1641427_at:406:505; Interrogation_Position=3419; Antisense; GTCCACCGCTGTTATGATTTTCTAC
>probe:Drosophila_2:1641427_at:443:461; Interrogation_Position=3434; Antisense; GATTTTCTACAGTACTTAACGACTT
>probe:Drosophila_2:1641427_at:549:381; Interrogation_Position=3459; Antisense; GAACGCATATTTCCTCTTTCGGGAA
>probe:Drosophila_2:1641427_at:280:245; Interrogation_Position=3567; Antisense; AATTTAGATTTTCGCTACACTGTAG
>probe:Drosophila_2:1641427_at:564:157; Interrogation_Position=3583; Antisense; ACACTGTAGCGCCTTCGTTTAATTA

Paste this into a BLAST search page for me
ATTTTCGTTCCTAATTTTGCTATTGAATTTTGCTATTGAACTGCGTTCGAGAACTGCGTTCGAATCCATTTCACACGAATCCATTTCACACCCAATTTAACATGCCGTGATGCTGTCAAATGAGAGATCCCACAATCCTCTAATTACTGATTTGTAGTCTAGAGTGCGCACGTTTGCACGTTTACTTTATGCGAGTTTAAATAAAGGTATGTCCACCGCTGTTATGTCCACCGCTGTTATGATTTTCTACGATTTTCTACAGTACTTAACGACTTGAACGCATATTTCCTCTTTCGGGAAAATTTAGATTTTCGCTACACTGTAGACACTGTAGCGCCTTCGTTTAATTA

Full Affymetrix probeset data:

Annotations for 1641427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720