FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641428_at:

>probe:Drosophila_2:1641428_at:310:163; Interrogation_Position=1153; Antisense; AAATTGCTCGCGGAGATCCTGGCCG
>probe:Drosophila_2:1641428_at:485:675; Interrogation_Position=1205; Antisense; TAGACTACGACACCCTGATGGGCAT
>probe:Drosophila_2:1641428_at:523:163; Interrogation_Position=1231; Antisense; AAATATCTGAACTGCGTGGTGTCCG
>probe:Drosophila_2:1641428_at:332:131; Interrogation_Position=1275; Antisense; ACCGGCGTTCATCGTGGATCGAATG
>probe:Drosophila_2:1641428_at:530:527; Interrogation_Position=1355; Antisense; GGGAGGACGACTTAGTGCACATCAA
>probe:Drosophila_2:1641428_at:586:7; Interrogation_Position=1428; Antisense; ATTCCGACCGGAGCGCTTTGACGAG
>probe:Drosophila_2:1641428_at:714:159; Interrogation_Position=1457; Antisense; ACAAGCACGAGATCCGGCAGTTCAC
>probe:Drosophila_2:1641428_at:114:589; Interrogation_Position=1494; Antisense; TGGAGTGGGCCAACGAAGCTGCATA
>probe:Drosophila_2:1641428_at:11:207; Interrogation_Position=1509; Antisense; AAGCTGCATAGGCAACCGGCTGGCT
>probe:Drosophila_2:1641428_at:482:131; Interrogation_Position=1523; Antisense; ACCGGCTGGCTCTCATGGAGGTGAA
>probe:Drosophila_2:1641428_at:635:587; Interrogation_Position=1538; Antisense; TGGAGGTGAAGTCCCTGATCTTCCA
>probe:Drosophila_2:1641428_at:472:605; Interrogation_Position=1553; Antisense; TGATCTTCCAGTTGGTCCTGCGCTA
>probe:Drosophila_2:1641428_at:55:59; Interrogation_Position=1612; Antisense; ATGATGAGCAGCATCTCCGGTTTCC
>probe:Drosophila_2:1641428_at:654:469; Interrogation_Position=1656; Antisense; GTTCTGGTGCAAGTTGGAGTCCCGT

Paste this into a BLAST search page for me
AAATTGCTCGCGGAGATCCTGGCCGTAGACTACGACACCCTGATGGGCATAAATATCTGAACTGCGTGGTGTCCGACCGGCGTTCATCGTGGATCGAATGGGGAGGACGACTTAGTGCACATCAAATTCCGACCGGAGCGCTTTGACGAGACAAGCACGAGATCCGGCAGTTCACTGGAGTGGGCCAACGAAGCTGCATAAAGCTGCATAGGCAACCGGCTGGCTACCGGCTGGCTCTCATGGAGGTGAATGGAGGTGAAGTCCCTGATCTTCCATGATCTTCCAGTTGGTCCTGCGCTAATGATGAGCAGCATCTCCGGTTTCCGTTCTGGTGCAAGTTGGAGTCCCGT

Full Affymetrix probeset data:

Annotations for 1641428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720