FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641429_at:

>probe:Drosophila_2:1641429_at:526:23; Interrogation_Position=306; Antisense; ATATCCCAGGGATCTGGTGTTGCGC
>probe:Drosophila_2:1641429_at:404:319; Interrogation_Position=331; Antisense; GCCCAGGTGGATCAGCGTTTGTTCT
>probe:Drosophila_2:1641429_at:162:123; Interrogation_Position=344; Antisense; AGCGTTTGTTCTTTGATGCCAGCAT
>probe:Drosophila_2:1641429_at:265:313; Interrogation_Position=361; Antisense; GCCAGCATTCTGTTTATGTCGCTGC
>probe:Drosophila_2:1641429_at:491:599; Interrogation_Position=390; Antisense; TGTCAGTATACCCTATTTTCTTCGC
>probe:Drosophila_2:1641429_at:532:701; Interrogation_Position=405; Antisense; TTTTCTTCGCCAAGTAAGCCTGGTA
>probe:Drosophila_2:1641429_at:420:31; Interrogation_Position=491; Antisense; ATAATCCCTATTTGACCGGGTCGCA
>probe:Drosophila_2:1641429_at:580:501; Interrogation_Position=510; Antisense; GTCGCAACTGACCATAGCTGATTTA
>probe:Drosophila_2:1641429_at:342:15; Interrogation_Position=530; Antisense; ATTTATGCTGCGGAGCTACTGCATC
>probe:Drosophila_2:1641429_at:707:577; Interrogation_Position=561; Antisense; GGCCGCTGTTCTTGATCTGGATGAG
>probe:Drosophila_2:1641429_at:16:215; Interrogation_Position=598; Antisense; AAGGTGGCTGCTTGGTTCGAACGAC
>probe:Drosophila_2:1641429_at:605:533; Interrogation_Position=611; Antisense; GGTTCGAACGACTCTCTAAGTTGCC
>probe:Drosophila_2:1641429_at:91:659; Interrogation_Position=627; Antisense; TAAGTTGCCCCACTATGAGGAAGAC
>probe:Drosophila_2:1641429_at:637:389; Interrogation_Position=687; Antisense; GAAACCCGTATTAAATCTGGAGCAA

Paste this into a BLAST search page for me
ATATCCCAGGGATCTGGTGTTGCGCGCCCAGGTGGATCAGCGTTTGTTCTAGCGTTTGTTCTTTGATGCCAGCATGCCAGCATTCTGTTTATGTCGCTGCTGTCAGTATACCCTATTTTCTTCGCTTTTCTTCGCCAAGTAAGCCTGGTAATAATCCCTATTTGACCGGGTCGCAGTCGCAACTGACCATAGCTGATTTAATTTATGCTGCGGAGCTACTGCATCGGCCGCTGTTCTTGATCTGGATGAGAAGGTGGCTGCTTGGTTCGAACGACGGTTCGAACGACTCTCTAAGTTGCCTAAGTTGCCCCACTATGAGGAAGACGAAACCCGTATTAAATCTGGAGCAA

Full Affymetrix probeset data:

Annotations for 1641429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720