FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641430_at:

>probe:Drosophila_2:1641430_at:164:473; Interrogation_Position=1020; Antisense; GTTAATGTATTTTCTACCGTCAAAT
>probe:Drosophila_2:1641430_at:506:695; Interrogation_Position=545; Antisense; TTTCGCTGTACACGCGCAGTTTGAA
>probe:Drosophila_2:1641430_at:511:559; Interrogation_Position=574; Antisense; GGAAAACTATCGCAGGGCATCCTGG
>probe:Drosophila_2:1641430_at:72:81; Interrogation_Position=587; Antisense; AGGGCATCCTGGTCAAGGTGTTCCC
>probe:Drosophila_2:1641430_at:426:653; Interrogation_Position=620; Antisense; TCAAGCGCCGCAAGATGCACTTCCA
>probe:Drosophila_2:1641430_at:137:513; Interrogation_Position=667; Antisense; GTGATCCTGGGCAACAATGGCTACA
>probe:Drosophila_2:1641430_at:68:667; Interrogation_Position=688; Antisense; TACATCTGGATATCGCCGACCAAGG
>probe:Drosophila_2:1641430_at:184:529; Interrogation_Position=735; Antisense; GGGAGGATTCGCTCAGAACCTGAAC
>probe:Drosophila_2:1641430_at:94:605; Interrogation_Position=788; Antisense; TGATCGCCCGGCTGAGGAACTCCAT
>probe:Drosophila_2:1641430_at:484:635; Interrogation_Position=815; Antisense; TCGCGCTGGCCAAGTGCAAGCTGAT
>probe:Drosophila_2:1641430_at:210:605; Interrogation_Position=839; Antisense; TGATTTACGACACCAGCATCCAGTA
>probe:Drosophila_2:1641430_at:596:137; Interrogation_Position=869; Antisense; ACGAGGAGTCCCTGCGCTACGAGGC
>probe:Drosophila_2:1641430_at:94:113; Interrogation_Position=908; Antisense; AGCAGAACGCCATCTACGACATCGG
>probe:Drosophila_2:1641430_at:91:671; Interrogation_Position=922; Antisense; TACGACATCGGCCAGCAGACGCAGG

Paste this into a BLAST search page for me
GTTAATGTATTTTCTACCGTCAAATTTTCGCTGTACACGCGCAGTTTGAAGGAAAACTATCGCAGGGCATCCTGGAGGGCATCCTGGTCAAGGTGTTCCCTCAAGCGCCGCAAGATGCACTTCCAGTGATCCTGGGCAACAATGGCTACATACATCTGGATATCGCCGACCAAGGGGGAGGATTCGCTCAGAACCTGAACTGATCGCCCGGCTGAGGAACTCCATTCGCGCTGGCCAAGTGCAAGCTGATTGATTTACGACACCAGCATCCAGTAACGAGGAGTCCCTGCGCTACGAGGCAGCAGAACGCCATCTACGACATCGGTACGACATCGGCCAGCAGACGCAGG

Full Affymetrix probeset data:

Annotations for 1641430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720