Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641432_a_at:

>probe:Drosophila_2:1641432_a_at:367:559; Interrogation_Position=298; Antisense; GGACAAGCACATTGGTTGCGCCACC
>probe:Drosophila_2:1641432_a_at:679:379; Interrogation_Position=379; Antisense; GAACCACTGGTTCGTCTACAACGAG
>probe:Drosophila_2:1641432_a_at:608:159; Interrogation_Position=396; Antisense; ACAACGAGCGCATGTCCATCGAGTC
>probe:Drosophila_2:1641432_a_at:703:147; Interrogation_Position=440; Antisense; ACTTTGGCCATCCAGTTCGGTGATA
>probe:Drosophila_2:1641432_a_at:19:55; Interrogation_Position=491; Antisense; ATGAGTCGTCCCTTTGGTGTGGCCA
>probe:Drosophila_2:1641432_a_at:120:533; Interrogation_Position=506; Antisense; GGTGTGGCCATTCTATTTGCCGGCA
>probe:Drosophila_2:1641432_a_at:242:689; Interrogation_Position=519; Antisense; TATTTGCCGGCATCGAGGCGGGACA
>probe:Drosophila_2:1641432_a_at:114:89; Interrogation_Position=549; Antisense; AGTTGTGGCACATGGATCCCTCCGG
>probe:Drosophila_2:1641432_a_at:642:617; Interrogation_Position=636; Antisense; TGCAGGACTTATTTAGACCCGATTT
>probe:Drosophila_2:1641432_a_at:87:105; Interrogation_Position=650; Antisense; AGACCCGATTTGACTCTCGATGAGG
>probe:Drosophila_2:1641432_a_at:309:439; Interrogation_Position=671; Antisense; GAGGCTATCGACATTTCGCTCAACA
>probe:Drosophila_2:1641432_a_at:619:691; Interrogation_Position=684; Antisense; TTTCGCTCAACACACTTAAACAGGT
>probe:Drosophila_2:1641432_a_at:123:427; Interrogation_Position=765; Antisense; GAGAGTTCTACATGTTCACCAAGGA
>probe:Drosophila_2:1641432_a_at:356:691; Interrogation_Position=816; Antisense; TTGCGTAAGCGGCAGTGGTTTTAAA

Paste this into a BLAST search page for me
GGACAAGCACATTGGTTGCGCCACCGAACCACTGGTTCGTCTACAACGAGACAACGAGCGCATGTCCATCGAGTCACTTTGGCCATCCAGTTCGGTGATAATGAGTCGTCCCTTTGGTGTGGCCAGGTGTGGCCATTCTATTTGCCGGCATATTTGCCGGCATCGAGGCGGGACAAGTTGTGGCACATGGATCCCTCCGGTGCAGGACTTATTTAGACCCGATTTAGACCCGATTTGACTCTCGATGAGGGAGGCTATCGACATTTCGCTCAACATTTCGCTCAACACACTTAAACAGGTGAGAGTTCTACATGTTCACCAAGGATTGCGTAAGCGGCAGTGGTTTTAAA

Full Affymetrix probeset data:

Annotations for 1641432_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime