Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641435_at:

>probe:Drosophila_2:1641435_at:133:191; Interrogation_Position=3298; Antisense; AACATATACCTACAAGCTGCCATCG
>probe:Drosophila_2:1641435_at:393:269; Interrogation_Position=3318; Antisense; CATCGACTACGTTTGTGGCTGACAG
>probe:Drosophila_2:1641435_at:244:719; Interrogation_Position=3346; Antisense; TTCCGTGTTCGTTGAGTTGGAGTTC
>probe:Drosophila_2:1641435_at:136:111; Interrogation_Position=3408; Antisense; AGAATTCGATTTCGGCTCTGGTGCT
>probe:Drosophila_2:1641435_at:156:523; Interrogation_Position=3443; Antisense; GTGGCCATTGCCTTCTTTAAGCAGG
>probe:Drosophila_2:1641435_at:649:711; Interrogation_Position=3455; Antisense; TTCTTTAAGCAGGATCTGGCCACCA
>probe:Drosophila_2:1641435_at:726:479; Interrogation_Position=3480; Antisense; GTTTCCTCAGCTTCGTGTGGAGCAA
>probe:Drosophila_2:1641435_at:573:115; Interrogation_Position=3504; Antisense; AGCTTAACGATGTCGCCGCCGATCT
>probe:Drosophila_2:1641435_at:705:381; Interrogation_Position=3565; Antisense; GAACGAGCCAATCAACCAGCGCGAG
>probe:Drosophila_2:1641435_at:591:427; Interrogation_Position=3587; Antisense; GAGATTGAACAGATGGCCGACCAGA
>probe:Drosophila_2:1641435_at:717:405; Interrogation_Position=3654; Antisense; GACTGATAGTCGCATTAGTTGTTCA
>probe:Drosophila_2:1641435_at:264:495; Interrogation_Position=3684; Antisense; GTCACATTTCGAGGTATTCGCGGTA
>probe:Drosophila_2:1641435_at:491:7; Interrogation_Position=3699; Antisense; ATTCGCGGTAGGTATTCATTTGGTT
>probe:Drosophila_2:1641435_at:39:471; Interrogation_Position=3829; Antisense; GTTCGTTATCCACTCTTATAGCTAA

Paste this into a BLAST search page for me
AACATATACCTACAAGCTGCCATCGCATCGACTACGTTTGTGGCTGACAGTTCCGTGTTCGTTGAGTTGGAGTTCAGAATTCGATTTCGGCTCTGGTGCTGTGGCCATTGCCTTCTTTAAGCAGGTTCTTTAAGCAGGATCTGGCCACCAGTTTCCTCAGCTTCGTGTGGAGCAAAGCTTAACGATGTCGCCGCCGATCTGAACGAGCCAATCAACCAGCGCGAGGAGATTGAACAGATGGCCGACCAGAGACTGATAGTCGCATTAGTTGTTCAGTCACATTTCGAGGTATTCGCGGTAATTCGCGGTAGGTATTCATTTGGTTGTTCGTTATCCACTCTTATAGCTAA

Full Affymetrix probeset data:

Annotations for 1641435_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime