Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641436_at:

>probe:Drosophila_2:1641436_at:229:179; Interrogation_Position=1750; Antisense; AAAAATTTAGCTGTACGCCGCGCGC
>probe:Drosophila_2:1641436_at:580:141; Interrogation_Position=1841; Antisense; ACTGGCACCAGGCTATTTGCTAACA
>probe:Drosophila_2:1641436_at:676:691; Interrogation_Position=1901; Antisense; TTTGTGGGCGTCAGCAATTGCCGCA
>probe:Drosophila_2:1641436_at:286:319; Interrogation_Position=1920; Antisense; GCCGCACACACGTCTGAGTTGAAAT
>probe:Drosophila_2:1641436_at:236:353; Interrogation_Position=1952; Antisense; GCAGCCGTTAATTGTTGATCCGCAC
>probe:Drosophila_2:1641436_at:362:467; Interrogation_Position=1965; Antisense; GTTGATCCGCACGATTTGAGACTGA
>probe:Drosophila_2:1641436_at:566:559; Interrogation_Position=2069; Antisense; GGAAAAGGCCGAGCGCATCTATCAG
>probe:Drosophila_2:1641436_at:145:347; Interrogation_Position=2083; Antisense; GCATCTATCAGTTCCTGCTTGAGAA
>probe:Drosophila_2:1641436_at:217:723; Interrogation_Position=2101; Antisense; TTGAGAATCCATTGCGACGCTACGT
>probe:Drosophila_2:1641436_at:615:185; Interrogation_Position=2145; Antisense; AACAATGGCAGTTTCGCGGACTACG
>probe:Drosophila_2:1641436_at:77:137; Interrogation_Position=2167; Antisense; ACGAGTCCGAATTCAATCTCTACTA
>probe:Drosophila_2:1641436_at:74:667; Interrogation_Position=2187; Antisense; TACTATCGCATGACCACCAATGGAA
>probe:Drosophila_2:1641436_at:689:49; Interrogation_Position=2217; Antisense; ATGCGAGCGCCACCTAATTAAGTAC
>probe:Drosophila_2:1641436_at:667:513; Interrogation_Position=2249; Antisense; GTGTTGTGAATACTGTAGCCCTTTT

Paste this into a BLAST search page for me
AAAAATTTAGCTGTACGCCGCGCGCACTGGCACCAGGCTATTTGCTAACATTTGTGGGCGTCAGCAATTGCCGCAGCCGCACACACGTCTGAGTTGAAATGCAGCCGTTAATTGTTGATCCGCACGTTGATCCGCACGATTTGAGACTGAGGAAAAGGCCGAGCGCATCTATCAGGCATCTATCAGTTCCTGCTTGAGAATTGAGAATCCATTGCGACGCTACGTAACAATGGCAGTTTCGCGGACTACGACGAGTCCGAATTCAATCTCTACTATACTATCGCATGACCACCAATGGAAATGCGAGCGCCACCTAATTAAGTACGTGTTGTGAATACTGTAGCCCTTTT

Full Affymetrix probeset data:

Annotations for 1641436_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime