FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641443_at:

>probe:Drosophila_2:1641443_at:670:719; Interrogation_Position=1021; Antisense; TTCCTTCCGGGCGTAGATATCACAG
>probe:Drosophila_2:1641443_at:131:439; Interrogation_Position=592; Antisense; GAGGCGGCGCATACAACATTGGAGC
>probe:Drosophila_2:1641443_at:194:223; Interrogation_Position=622; Antisense; AAGGTGCCAGCTGTTATTCTTCCCT
>probe:Drosophila_2:1641443_at:193:527; Interrogation_Position=647; Antisense; GGGAACCCAGCATTGATGACGACTT
>probe:Drosophila_2:1641443_at:44:409; Interrogation_Position=664; Antisense; GACGACTTCAATCTGTCACTTGACT
>probe:Drosophila_2:1641443_at:601:439; Interrogation_Position=697; Antisense; GATGTCTTGGGCTCTGTAGACCATC
>probe:Drosophila_2:1641443_at:2:679; Interrogation_Position=725; Antisense; TAGTCGAGCTTTTGTCCAGGGTGGA
>probe:Drosophila_2:1641443_at:241:123; Interrogation_Position=749; Antisense; AGCGATCCATGTTGGTGCCACGTGA
>probe:Drosophila_2:1641443_at:615:343; Interrogation_Position=780; Antisense; GCATTGGATTAATCCCGATGCCGCT
>probe:Drosophila_2:1641443_at:542:615; Interrogation_Position=807; Antisense; TGCAGCAGCCTATATCTTCCCAAAG
>probe:Drosophila_2:1641443_at:494:419; Interrogation_Position=844; Antisense; GAGCAGTTGGATTACCATGCCACAG
>probe:Drosophila_2:1641443_at:727:487; Interrogation_Position=904; Antisense; GTACTGGATCATCTGCGAGGTCGCC
>probe:Drosophila_2:1641443_at:395:433; Interrogation_Position=920; Antisense; GAGGTCGCCGTGTGGATGCTATCCA
>probe:Drosophila_2:1641443_at:96:719; Interrogation_Position=995; Antisense; TTCGCACTATTATGTCCTGGACGGG

Paste this into a BLAST search page for me
TTCCTTCCGGGCGTAGATATCACAGGAGGCGGCGCATACAACATTGGAGCAAGGTGCCAGCTGTTATTCTTCCCTGGGAACCCAGCATTGATGACGACTTGACGACTTCAATCTGTCACTTGACTGATGTCTTGGGCTCTGTAGACCATCTAGTCGAGCTTTTGTCCAGGGTGGAAGCGATCCATGTTGGTGCCACGTGAGCATTGGATTAATCCCGATGCCGCTTGCAGCAGCCTATATCTTCCCAAAGGAGCAGTTGGATTACCATGCCACAGGTACTGGATCATCTGCGAGGTCGCCGAGGTCGCCGTGTGGATGCTATCCATTCGCACTATTATGTCCTGGACGGG

Full Affymetrix probeset data:

Annotations for 1641443_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720