Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641444_a_at:

>probe:Drosophila_2:1641444_a_at:666:611; Interrogation_Position=106; Antisense; TGAACAGCCGTATCCAAAGTAGAAT
>probe:Drosophila_2:1641444_a_at:140:255; Interrogation_Position=120; Antisense; CAAAGTAGAATTCCCATGTCCGGCT
>probe:Drosophila_2:1641444_a_at:630:503; Interrogation_Position=137; Antisense; GTCCGGCTCCGGTCTCGACGAGAAT
>probe:Drosophila_2:1641444_a_at:51:1; Interrogation_Position=146; Antisense; CGGTCTCGACGAGAATCCCTTCGGG
>probe:Drosophila_2:1641444_a_at:267:585; Interrogation_Position=181; Antisense; TGGACAATCCGTTTGCGGACCCCGC
>probe:Drosophila_2:1641444_a_at:369:115; Interrogation_Position=211; Antisense; AGCAGGCACGACGACTCCAGAGCGG
>probe:Drosophila_2:1641444_a_at:33:321; Interrogation_Position=240; Antisense; GCCCTTGTCTCTCTTGAGGATTACA
>probe:Drosophila_2:1641444_a_at:340:205; Interrogation_Position=285; Antisense; AAGCCGCAGCTGCAGATCAACTCAA
>probe:Drosophila_2:1641444_a_at:189:535; Interrogation_Position=326; Antisense; GGTCCAGCCGCTATCGCAGAACATT
>probe:Drosophila_2:1641444_a_at:666:193; Interrogation_Position=34; Antisense; AACTGAGCAGAGTCTTAGGGAAAAT
>probe:Drosophila_2:1641444_a_at:59:677; Interrogation_Position=389; Antisense; TAGCACCAGCATACAGATCACCTCG
>probe:Drosophila_2:1641444_a_at:636:357; Interrogation_Position=73; Antisense; GCAAAGTGCGAGTCAGTGCGTTTTT
>probe:Drosophila_2:1641444_a_at:489:265; Interrogation_Position=86; Antisense; CAGTGCGTTTTTCTGGTCATTGAAC
>probe:Drosophila_2:1641444_a_at:317:591; Interrogation_Position=99; Antisense; TGGTCATTGAACAGCCGTATCCAAA

Paste this into a BLAST search page for me
TGAACAGCCGTATCCAAAGTAGAATCAAAGTAGAATTCCCATGTCCGGCTGTCCGGCTCCGGTCTCGACGAGAATCGGTCTCGACGAGAATCCCTTCGGGTGGACAATCCGTTTGCGGACCCCGCAGCAGGCACGACGACTCCAGAGCGGGCCCTTGTCTCTCTTGAGGATTACAAAGCCGCAGCTGCAGATCAACTCAAGGTCCAGCCGCTATCGCAGAACATTAACTGAGCAGAGTCTTAGGGAAAATTAGCACCAGCATACAGATCACCTCGGCAAAGTGCGAGTCAGTGCGTTTTTCAGTGCGTTTTTCTGGTCATTGAACTGGTCATTGAACAGCCGTATCCAAA

Full Affymetrix probeset data:

Annotations for 1641444_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime