Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641446_s_at:

>probe:Drosophila_2:1641446_s_at:7:427; Interrogation_Position=1035; Antisense; GAGAGGCTGCCGTGTATATTCTGAA
>probe:Drosophila_2:1641446_s_at:6:525; Interrogation_Position=1108; Antisense; GGGCGATGACACCACCGATGAAGAT
>probe:Drosophila_2:1641446_s_at:443:49; Interrogation_Position=1131; Antisense; ATGCCATGAGAGTGCTTCGAGGCTT
>probe:Drosophila_2:1641446_s_at:611:531; Interrogation_Position=1156; Antisense; GGGTCGCTCGTTTAGAATTTCTGCT
>probe:Drosophila_2:1641446_s_at:565:363; Interrogation_Position=1170; Antisense; GAATTTCTGCTGATGCCCAGATTCA
>probe:Drosophila_2:1641446_s_at:441:411; Interrogation_Position=1189; Antisense; GATTCAAACTTATGCGGATTTCCGG
>probe:Drosophila_2:1641446_s_at:237:719; Interrogation_Position=1208; Antisense; TTCCGGTTGCCCAAGCAGGCTGTAA
>probe:Drosophila_2:1641446_s_at:238:269; Interrogation_Position=1223; Antisense; CAGGCTGTAATGACCGATCTTCTCA
>probe:Drosophila_2:1641446_s_at:246:675; Interrogation_Position=1254; Antisense; TAGCCAATGTGTATGTTTCTTAGAT
>probe:Drosophila_2:1641446_s_at:504:209; Interrogation_Position=878; Antisense; AAGAAGGTGTCACTCACCTACCACT
>probe:Drosophila_2:1641446_s_at:649:95; Interrogation_Position=907; Antisense; AGATACGCCCGCAGCCCTGAAGGAT
>probe:Drosophila_2:1641446_s_at:686:265; Interrogation_Position=941; Antisense; CAGTTGGCTTCGGAGATCTGCACAA
>probe:Drosophila_2:1641446_s_at:569:451; Interrogation_Position=955; Antisense; GATCTGCACAAAGTTCGGATTCCGT
>probe:Drosophila_2:1641446_s_at:698:9; Interrogation_Position=973; Antisense; ATTCCGTGCGAATCAGGCCCATGAA

Paste this into a BLAST search page for me
GAGAGGCTGCCGTGTATATTCTGAAGGGCGATGACACCACCGATGAAGATATGCCATGAGAGTGCTTCGAGGCTTGGGTCGCTCGTTTAGAATTTCTGCTGAATTTCTGCTGATGCCCAGATTCAGATTCAAACTTATGCGGATTTCCGGTTCCGGTTGCCCAAGCAGGCTGTAACAGGCTGTAATGACCGATCTTCTCATAGCCAATGTGTATGTTTCTTAGATAAGAAGGTGTCACTCACCTACCACTAGATACGCCCGCAGCCCTGAAGGATCAGTTGGCTTCGGAGATCTGCACAAGATCTGCACAAAGTTCGGATTCCGTATTCCGTGCGAATCAGGCCCATGAA

Full Affymetrix probeset data:

Annotations for 1641446_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime