FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641449_at:

>probe:Drosophila_2:1641449_at:512:125; Interrogation_Position=4955; Antisense; AGCCGTATACCTGGACTGCCGAGAT
>probe:Drosophila_2:1641449_at:636:317; Interrogation_Position=4972; Antisense; GCCGAGATCTCCAACGTACTTGGGA
>probe:Drosophila_2:1641449_at:512:533; Interrogation_Position=4997; Antisense; GGTAATTTTCAATCTCTTCGAGCCG
>probe:Drosophila_2:1641449_at:431:553; Interrogation_Position=5021; Antisense; GGAGCTTCAGGAGTTCACGCGCAAA
>probe:Drosophila_2:1641449_at:182:325; Interrogation_Position=5039; Antisense; GCGCAAAGTGCCCATCAATCATATA
>probe:Drosophila_2:1641449_at:59:161; Interrogation_Position=5080; Antisense; ACAAGCATGCGAAGCCCGTGTTTAG
>probe:Drosophila_2:1641449_at:636:475; Interrogation_Position=5136; Antisense; GTTAGTTGTCAATTTACCTGCATGG
>probe:Drosophila_2:1641449_at:145:225; Interrogation_Position=5196; Antisense; AAGGACCAGGCCAAGCTATCGGCTG
>probe:Drosophila_2:1641449_at:49:25; Interrogation_Position=5261; Antisense; ATATGATGATTCCAGCCCAGTCTAG
>probe:Drosophila_2:1641449_at:657:261; Interrogation_Position=5273; Antisense; CAGCCCAGTCTAGTTTCTGCTAAAC
>probe:Drosophila_2:1641449_at:497:363; Interrogation_Position=5304; Antisense; GAATTTGCTTTCTAGCCAAGACGTA
>probe:Drosophila_2:1641449_at:513:525; Interrogation_Position=5352; Antisense; GGGCACCTAATGAACTTAACTGTAT
>probe:Drosophila_2:1641449_at:558:209; Interrogation_Position=5392; Antisense; AATACTTTTCCATCGCTTTAATAGA
>probe:Drosophila_2:1641449_at:118:99; Interrogation_Position=5515; Antisense; AGATGCTATGCCAATTTCCTCAAAT

Paste this into a BLAST search page for me
AGCCGTATACCTGGACTGCCGAGATGCCGAGATCTCCAACGTACTTGGGAGGTAATTTTCAATCTCTTCGAGCCGGGAGCTTCAGGAGTTCACGCGCAAAGCGCAAAGTGCCCATCAATCATATAACAAGCATGCGAAGCCCGTGTTTAGGTTAGTTGTCAATTTACCTGCATGGAAGGACCAGGCCAAGCTATCGGCTGATATGATGATTCCAGCCCAGTCTAGCAGCCCAGTCTAGTTTCTGCTAAACGAATTTGCTTTCTAGCCAAGACGTAGGGCACCTAATGAACTTAACTGTATAATACTTTTCCATCGCTTTAATAGAAGATGCTATGCCAATTTCCTCAAAT

Full Affymetrix probeset data:

Annotations for 1641449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720