FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641451_at:

>probe:Drosophila_2:1641451_at:198:39; Interrogation_Position=1033; Antisense; ATCTAAACGCTTTCGCTTGTACATA
>probe:Drosophila_2:1641451_at:324:299; Interrogation_Position=1076; Antisense; CGCTGGGCGGCTTTCGATCGTTTAA
>probe:Drosophila_2:1641451_at:11:451; Interrogation_Position=1091; Antisense; GATCGTTTAATGTGGTTCTGCTTAC
>probe:Drosophila_2:1641451_at:594:455; Interrogation_Position=1128; Antisense; GATAACCTCTTGAACTCGGGAGCTT
>probe:Drosophila_2:1641451_at:491:559; Interrogation_Position=1203; Antisense; GGAAATTGTTTCTACGACTTCTTCT
>probe:Drosophila_2:1641451_at:479:403; Interrogation_Position=1218; Antisense; GACTTCTTCTTCTTCATAATCTTCA
>probe:Drosophila_2:1641451_at:439:585; Interrogation_Position=684; Antisense; TGGAATGGCCAAGGCAGCTGTCCAC
>probe:Drosophila_2:1641451_at:201:609; Interrogation_Position=732; Antisense; TGAGAAATCCGGTCTGCCAGCTGGT
>probe:Drosophila_2:1641451_at:186:629; Interrogation_Position=769; Antisense; TCCATACTTCCCGTAACTCTAGATA
>probe:Drosophila_2:1641451_at:386:191; Interrogation_Position=783; Antisense; AACTCTAGATACACCCATGAACCGT
>probe:Drosophila_2:1641451_at:380:95; Interrogation_Position=825; Antisense; AGATTTTGGAACCTGGACACCGCTC
>probe:Drosophila_2:1641451_at:2:439; Interrogation_Position=894; Antisense; GAGGCCCAAAACTGGATCCCTGTTG
>probe:Drosophila_2:1641451_at:593:603; Interrogation_Position=914; Antisense; TGTTGCAGCTGATCACCACAAACGG
>probe:Drosophila_2:1641451_at:139:195; Interrogation_Position=934; Antisense; AACGGCATTACGCAGCTTATCGCTG

Paste this into a BLAST search page for me
ATCTAAACGCTTTCGCTTGTACATACGCTGGGCGGCTTTCGATCGTTTAAGATCGTTTAATGTGGTTCTGCTTACGATAACCTCTTGAACTCGGGAGCTTGGAAATTGTTTCTACGACTTCTTCTGACTTCTTCTTCTTCATAATCTTCATGGAATGGCCAAGGCAGCTGTCCACTGAGAAATCCGGTCTGCCAGCTGGTTCCATACTTCCCGTAACTCTAGATAAACTCTAGATACACCCATGAACCGTAGATTTTGGAACCTGGACACCGCTCGAGGCCCAAAACTGGATCCCTGTTGTGTTGCAGCTGATCACCACAAACGGAACGGCATTACGCAGCTTATCGCTG

Full Affymetrix probeset data:

Annotations for 1641451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720