Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641454_at:

>probe:Drosophila_2:1641454_at:32:625; Interrogation_Position=1396; Antisense; TGCGCGATGCCATTGTCGGTCTAAA
>probe:Drosophila_2:1641454_at:618:383; Interrogation_Position=1421; Antisense; GAACATGTGTGGTCGCATTCTGGGC
>probe:Drosophila_2:1641454_at:7:595; Interrogation_Position=1441; Antisense; TGGGCTCCAATACCATCATTCAGGG
>probe:Drosophila_2:1641454_at:198:399; Interrogation_Position=1490; Antisense; GACACCGCAGTCTTATTTTGACGGC
>probe:Drosophila_2:1641454_at:443:329; Interrogation_Position=1513; Antisense; GCGTGATTGATGTGCTCCACTCGAA
>probe:Drosophila_2:1641454_at:357:333; Interrogation_Position=1559; Antisense; GCTGAAACAGGTGCGTGGCCTCGAT
>probe:Drosophila_2:1641454_at:232:509; Interrogation_Position=1623; Antisense; GTGAGCATCGAACGCTTCCCGGAAT
>probe:Drosophila_2:1641454_at:172:157; Interrogation_Position=1657; Antisense; ACACCCACTTTGTCCAGGAGATGGT
>probe:Drosophila_2:1641454_at:582:347; Interrogation_Position=1711; Antisense; GCAGCTGCTTTGAGTACCCGGGATA
>probe:Drosophila_2:1641454_at:662:139; Interrogation_Position=1735; Antisense; ACGTGCGGATCGTACTTACTGTGCC
>probe:Drosophila_2:1641454_at:304:79; Interrogation_Position=1788; Antisense; AGGATTGCCGAGTTCTGCGATCGCC
>probe:Drosophila_2:1641454_at:666:549; Interrogation_Position=1823; Antisense; GGAGTCGCGCAATTTCATTGAGCAC
>probe:Drosophila_2:1641454_at:348:113; Interrogation_Position=1843; Antisense; AGCACGGACTGCTCGACTGCGATGA
>probe:Drosophila_2:1641454_at:546:63; Interrogation_Position=1867; Antisense; ATGTGGCCTTTTGAGCTGGGAGCAA

Paste this into a BLAST search page for me
TGCGCGATGCCATTGTCGGTCTAAAGAACATGTGTGGTCGCATTCTGGGCTGGGCTCCAATACCATCATTCAGGGGACACCGCAGTCTTATTTTGACGGCGCGTGATTGATGTGCTCCACTCGAAGCTGAAACAGGTGCGTGGCCTCGATGTGAGCATCGAACGCTTCCCGGAATACACCCACTTTGTCCAGGAGATGGTGCAGCTGCTTTGAGTACCCGGGATAACGTGCGGATCGTACTTACTGTGCCAGGATTGCCGAGTTCTGCGATCGCCGGAGTCGCGCAATTTCATTGAGCACAGCACGGACTGCTCGACTGCGATGAATGTGGCCTTTTGAGCTGGGAGCAA

Full Affymetrix probeset data:

Annotations for 1641454_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime