FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641455_at:

>probe:Drosophila_2:1641455_at:213:13; Interrogation_Position=113; Antisense; ATTAGCCATTTCTTGCGAGCGACGA
>probe:Drosophila_2:1641455_at:33:345; Interrogation_Position=152; Antisense; GCATTGGGTCCAATCCTGCAAAGAA
>probe:Drosophila_2:1641455_at:62:693; Interrogation_Position=205; Antisense; TTTGACCAATCGACAGGCATTCCGC
>probe:Drosophila_2:1641455_at:389:289; Interrogation_Position=277; Antisense; CGGCATCGATGAGACCCACCTGGTG
>probe:Drosophila_2:1641455_at:652:537; Interrogation_Position=29; Antisense; GGTAAACGAACCCACACATGAGCAG
>probe:Drosophila_2:1641455_at:78:351; Interrogation_Position=346; Antisense; GCAGAAGGTGCAATCCCTGATGGAA
>probe:Drosophila_2:1641455_at:621:43; Interrogation_Position=410; Antisense; ATCGACCTGCTGTGGATCTCGGGCA
>probe:Drosophila_2:1641455_at:85:435; Interrogation_Position=437; Antisense; GAGGGAGGCGACTACTACTTCAGCT
>probe:Drosophila_2:1641455_at:85:541; Interrogation_Position=477; Antisense; GGTTCGAGGCGTACAAGCGGCTACA
>probe:Drosophila_2:1641455_at:724:665; Interrogation_Position=498; Antisense; TACAGCGGCCGACGATCAAGGCGAA
>probe:Drosophila_2:1641455_at:275:615; Interrogation_Position=528; Antisense; TGAAGTCCACACTGGGCGATCTGTA
>probe:Drosophila_2:1641455_at:397:253; Interrogation_Position=54; Antisense; CAAACAAGTTTCAACGCCGTGCGGT
>probe:Drosophila_2:1641455_at:129:41; Interrogation_Position=546; Antisense; ATCTGTATCACTACATGGGCTCCAG
>probe:Drosophila_2:1641455_at:171:5; Interrogation_Position=94; Antisense; ATTGTCCGCCATGGAGTTCATTAGC

Paste this into a BLAST search page for me
ATTAGCCATTTCTTGCGAGCGACGAGCATTGGGTCCAATCCTGCAAAGAATTTGACCAATCGACAGGCATTCCGCCGGCATCGATGAGACCCACCTGGTGGGTAAACGAACCCACACATGAGCAGGCAGAAGGTGCAATCCCTGATGGAAATCGACCTGCTGTGGATCTCGGGCAGAGGGAGGCGACTACTACTTCAGCTGGTTCGAGGCGTACAAGCGGCTACATACAGCGGCCGACGATCAAGGCGAATGAAGTCCACACTGGGCGATCTGTACAAACAAGTTTCAACGCCGTGCGGTATCTGTATCACTACATGGGCTCCAGATTGTCCGCCATGGAGTTCATTAGC

Full Affymetrix probeset data:

Annotations for 1641455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720