Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641457_at:

>probe:Drosophila_2:1641457_at:513:111; Interrogation_Position=3967; Antisense; AGCAAGGGCATCTCAGCGGCCACTG
>probe:Drosophila_2:1641457_at:628:163; Interrogation_Position=3995; Antisense; AAATCTCCGTGTCCGCCAAGAATCT
>probe:Drosophila_2:1641457_at:538:547; Interrogation_Position=4035; Antisense; GGATGACCAGGTGCACCACATGAAG
>probe:Drosophila_2:1641457_at:305:153; Interrogation_Position=4052; Antisense; ACATGAAGCGCGCTGCCTCTGAAGC
>probe:Drosophila_2:1641457_at:65:665; Interrogation_Position=4086; Antisense; TAAATCTAACCACAGCAAGCGCAGC
>probe:Drosophila_2:1641457_at:336:205; Interrogation_Position=4102; Antisense; AAGCGCAGCCAGTCGATGAGCACGG
>probe:Drosophila_2:1641457_at:689:443; Interrogation_Position=4116; Antisense; GATGAGCACGGAGCGTCCCAGTCAG
>probe:Drosophila_2:1641457_at:472:647; Interrogation_Position=4182; Antisense; TCATCATCATGCTGGCAAGCGCAGT
>probe:Drosophila_2:1641457_at:313:481; Interrogation_Position=4205; Antisense; GTTTGGATGCTGGATCTGGCGACAA
>probe:Drosophila_2:1641457_at:11:185; Interrogation_Position=4238; Antisense; AAAATGCCCCACTGGCTGGAGGAAC
>probe:Drosophila_2:1641457_at:315:225; Interrogation_Position=4291; Antisense; AAGGCAGGTCTGAAGCCAACGCCCG
>probe:Drosophila_2:1641457_at:475:685; Interrogation_Position=4317; Antisense; TTTGTTGGCCGAGCTACTAAAGGGT
>probe:Drosophila_2:1641457_at:542:353; Interrogation_Position=4446; Antisense; GCAGCGGCGCCATGTGAATTTTGAA
>probe:Drosophila_2:1641457_at:412:379; Interrogation_Position=4468; Antisense; GAAGCGCATGCTCCTAACAGAAAAT

Paste this into a BLAST search page for me
AGCAAGGGCATCTCAGCGGCCACTGAAATCTCCGTGTCCGCCAAGAATCTGGATGACCAGGTGCACCACATGAAGACATGAAGCGCGCTGCCTCTGAAGCTAAATCTAACCACAGCAAGCGCAGCAAGCGCAGCCAGTCGATGAGCACGGGATGAGCACGGAGCGTCCCAGTCAGTCATCATCATGCTGGCAAGCGCAGTGTTTGGATGCTGGATCTGGCGACAAAAAATGCCCCACTGGCTGGAGGAACAAGGCAGGTCTGAAGCCAACGCCCGTTTGTTGGCCGAGCTACTAAAGGGTGCAGCGGCGCCATGTGAATTTTGAAGAAGCGCATGCTCCTAACAGAAAAT

Full Affymetrix probeset data:

Annotations for 1641457_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime