FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641459_at:

>probe:Drosophila_2:1641459_at:720:499; Interrogation_Position=1570; Antisense; GTCGGCGCCATTGCAGTTGTATTCA
>probe:Drosophila_2:1641459_at:724:93; Interrogation_Position=1584; Antisense; AGTTGTATTCAAGCTGCCCAGTGGA
>probe:Drosophila_2:1641459_at:20:317; Interrogation_Position=1613; Antisense; GCCTAGAGCGCCGATTTAACCAGAC
>probe:Drosophila_2:1641459_at:646:403; Interrogation_Position=1635; Antisense; GACGGATTCGGTGCTTGACGTTTAT
>probe:Drosophila_2:1641459_at:303:611; Interrogation_Position=1650; Antisense; TGACGTTTATCACTATCTCTTCTGC
>probe:Drosophila_2:1641459_at:91:635; Interrogation_Position=1684; Antisense; TCGCCGGATGAGTTCGAGATCACAA
>probe:Drosophila_2:1641459_at:662:33; Interrogation_Position=1702; Antisense; ATCACAACGAATTTCCCGAAGCGCG
>probe:Drosophila_2:1641459_at:83:329; Interrogation_Position=1724; Antisense; GCGTGCTCTTCTCGAAAGCGAACTT
>probe:Drosophila_2:1641459_at:284:1; Interrogation_Position=1802; Antisense; AGGCCGTAGGACTCAAGAACCGCGA
>probe:Drosophila_2:1641459_at:361:201; Interrogation_Position=1819; Antisense; AACCGCGAGGTGCTGTTCGTTAACG
>probe:Drosophila_2:1641459_at:203:393; Interrogation_Position=1878; Antisense; GAAAGCATCATCGTGTTACCAGCAG
>probe:Drosophila_2:1641459_at:571:475; Interrogation_Position=1892; Antisense; GTTACCAGCAGCAACGCATTACCAA
>probe:Drosophila_2:1641459_at:344:485; Interrogation_Position=1936; Antisense; GTAGTCGTAGTCAACGTCCAAGTCG
>probe:Drosophila_2:1641459_at:548:679; Interrogation_Position=2030; Antisense; TAGGTTGATTCTCTGATCTGCCCAA

Paste this into a BLAST search page for me
GTCGGCGCCATTGCAGTTGTATTCAAGTTGTATTCAAGCTGCCCAGTGGAGCCTAGAGCGCCGATTTAACCAGACGACGGATTCGGTGCTTGACGTTTATTGACGTTTATCACTATCTCTTCTGCTCGCCGGATGAGTTCGAGATCACAAATCACAACGAATTTCCCGAAGCGCGGCGTGCTCTTCTCGAAAGCGAACTTAGGCCGTAGGACTCAAGAACCGCGAAACCGCGAGGTGCTGTTCGTTAACGGAAAGCATCATCGTGTTACCAGCAGGTTACCAGCAGCAACGCATTACCAAGTAGTCGTAGTCAACGTCCAAGTCGTAGGTTGATTCTCTGATCTGCCCAA

Full Affymetrix probeset data:

Annotations for 1641459_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720