FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641460_at:

>probe:Drosophila_2:1641460_at:380:555; Interrogation_Position=1017; Antisense; GGACCACTCAACCAAAGAACTCATC
>probe:Drosophila_2:1641460_at:495:9; Interrogation_Position=1057; Antisense; ATTCCTCCTTCCATTCGAAATGACA
>probe:Drosophila_2:1641460_at:406:167; Interrogation_Position=1074; Antisense; AAATGACATACTTTCGAGGTTCGAA
>probe:Drosophila_2:1641460_at:402:435; Interrogation_Position=1089; Antisense; GAGGTTCGAACAGCTCTACGATTGG
>probe:Drosophila_2:1641460_at:465:465; Interrogation_Position=1108; Antisense; GATTGGGATTGTTCGCATCATCTTA
>probe:Drosophila_2:1641460_at:319:161; Interrogation_Position=1154; Antisense; AAACTCTACGTTCAATTCAAGCCTA
>probe:Drosophila_2:1641460_at:474:187; Interrogation_Position=1178; Antisense; AACACTTAAGTTCATCTCTCGACTA
>probe:Drosophila_2:1641460_at:360:479; Interrogation_Position=746; Antisense; GTATAGCCGATTTTCCGTAATGAGT
>probe:Drosophila_2:1641460_at:455:129; Interrogation_Position=789; Antisense; ACCTTCACTTCCCTTGAAACATGTT
>probe:Drosophila_2:1641460_at:665:177; Interrogation_Position=826; Antisense; AAACGGTCTGTCTGTGAGTCTGTGA
>probe:Drosophila_2:1641460_at:127:491; Interrogation_Position=920; Antisense; GTACACTTTGTTCCAAACGATCCAA
>probe:Drosophila_2:1641460_at:504:451; Interrogation_Position=948; Antisense; GATCGATCTCTATCATCCACAGAAT
>probe:Drosophila_2:1641460_at:670:361; Interrogation_Position=978; Antisense; GAATTGTGTCTTATACTCATACTTG
>probe:Drosophila_2:1641460_at:212:645; Interrogation_Position=994; Antisense; TCATACTTGAAACCACCGGCAACGG

Paste this into a BLAST search page for me
GGACCACTCAACCAAAGAACTCATCATTCCTCCTTCCATTCGAAATGACAAAATGACATACTTTCGAGGTTCGAAGAGGTTCGAACAGCTCTACGATTGGGATTGGGATTGTTCGCATCATCTTAAAACTCTACGTTCAATTCAAGCCTAAACACTTAAGTTCATCTCTCGACTAGTATAGCCGATTTTCCGTAATGAGTACCTTCACTTCCCTTGAAACATGTTAAACGGTCTGTCTGTGAGTCTGTGAGTACACTTTGTTCCAAACGATCCAAGATCGATCTCTATCATCCACAGAATGAATTGTGTCTTATACTCATACTTGTCATACTTGAAACCACCGGCAACGG

Full Affymetrix probeset data:

Annotations for 1641460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720