FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641462_at:

>probe:Drosophila_2:1641462_at:340:611; Interrogation_Position=105; Antisense; TGACGACGACCCAGAGTTCATGGCG
>probe:Drosophila_2:1641462_at:430:317; Interrogation_Position=147; Antisense; GCCGGAGCCGCCAATTGTGGAGAAC
>probe:Drosophila_2:1641462_at:225:45; Interrogation_Position=239; Antisense; ATCGCTACAACGGACATCGCAGAGG
>probe:Drosophila_2:1641462_at:169:77; Interrogation_Position=291; Antisense; AGGAGGAGCTGGCTACCACAACAAC
>probe:Drosophila_2:1641462_at:26:463; Interrogation_Position=326; Antisense; GATTCAGGGACAACCGGCGCAACAA
>probe:Drosophila_2:1641462_at:263:455; Interrogation_Position=358; Antisense; GATCACATCGATCGCCGGAATCGGT
>probe:Drosophila_2:1641462_at:573:123; Interrogation_Position=422; Antisense; AGCGCTCCCATGATCATAACCAGAG
>probe:Drosophila_2:1641462_at:241:57; Interrogation_Position=449; Antisense; ATGATACTCCCAATAACGAACCACC
>probe:Drosophila_2:1641462_at:154:381; Interrogation_Position=466; Antisense; GAACCACCCATGAAGGTCAGACGCG
>probe:Drosophila_2:1641462_at:167:455; Interrogation_Position=481; Antisense; GTCAGACGCGACTATGGAAACTTTG
>probe:Drosophila_2:1641462_at:236:391; Interrogation_Position=49; Antisense; GAAAGGGACCTGAACTTCCTGGAGT
>probe:Drosophila_2:1641462_at:245:391; Interrogation_Position=497; Antisense; GAAACTTTGTGCCTGCATCCAAGGA
>probe:Drosophila_2:1641462_at:180:287; Interrogation_Position=67; Antisense; CTGGAGTCCTGCGAGCTTGAGTTCG
>probe:Drosophila_2:1641462_at:162:727; Interrogation_Position=83; Antisense; TTGAGTTCGCAGACCGCTTCACTGA

Paste this into a BLAST search page for me
TGACGACGACCCAGAGTTCATGGCGGCCGGAGCCGCCAATTGTGGAGAACATCGCTACAACGGACATCGCAGAGGAGGAGGAGCTGGCTACCACAACAACGATTCAGGGACAACCGGCGCAACAAGATCACATCGATCGCCGGAATCGGTAGCGCTCCCATGATCATAACCAGAGATGATACTCCCAATAACGAACCACCGAACCACCCATGAAGGTCAGACGCGGTCAGACGCGACTATGGAAACTTTGGAAAGGGACCTGAACTTCCTGGAGTGAAACTTTGTGCCTGCATCCAAGGACTGGAGTCCTGCGAGCTTGAGTTCGTTGAGTTCGCAGACCGCTTCACTGA

Full Affymetrix probeset data:

Annotations for 1641462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720