Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641463_at:

>probe:Drosophila_2:1641463_at:213:341; Interrogation_Position=490; Antisense; GCTTAGTTCAAATGCACGGATCCCT
>probe:Drosophila_2:1641463_at:303:617; Interrogation_Position=514; Antisense; TGCAGCTTCTGTTGGGACTCCTGTT
>probe:Drosophila_2:1641463_at:484:555; Interrogation_Position=528; Antisense; GGACTCCTGTTGATTGGCGTTGCCT
>probe:Drosophila_2:1641463_at:577:573; Interrogation_Position=543; Antisense; GGCGTTGCCTCCAGAATATTTAGAA
>probe:Drosophila_2:1641463_at:185:73; Interrogation_Position=574; Antisense; AGGAAAACCAGGCTTATCCTCACCA
>probe:Drosophila_2:1641463_at:641:693; Interrogation_Position=587; Antisense; TTATCCTCACCACAAACGAAACACG
>probe:Drosophila_2:1641463_at:342:155; Interrogation_Position=607; Antisense; ACACGCAATAAGTGCCTTTTCGCCA
>probe:Drosophila_2:1641463_at:296:719; Interrogation_Position=625; Antisense; TTCGCCACTCCACATGATATCTAAG
>probe:Drosophila_2:1641463_at:240:21; Interrogation_Position=666; Antisense; ATATCAAAAACACATTCCGTCCACC
>probe:Drosophila_2:1641463_at:389:629; Interrogation_Position=685; Antisense; TCCACCTTTTTCCTGCCTATAATTA
>probe:Drosophila_2:1641463_at:317:163; Interrogation_Position=841; Antisense; AAATTTCCTATGTCGCTTGTACTTT
>probe:Drosophila_2:1641463_at:606:411; Interrogation_Position=930; Antisense; GACCATTCCGAAAATGCTTACGTTT
>probe:Drosophila_2:1641463_at:74:147; Interrogation_Position=967; Antisense; ACTAGTATTTACCTGCCATATCCGA
>probe:Drosophila_2:1641463_at:252:307; Interrogation_Position=981; Antisense; GCCATATCCGAATAACCACTACCAT

Paste this into a BLAST search page for me
GCTTAGTTCAAATGCACGGATCCCTTGCAGCTTCTGTTGGGACTCCTGTTGGACTCCTGTTGATTGGCGTTGCCTGGCGTTGCCTCCAGAATATTTAGAAAGGAAAACCAGGCTTATCCTCACCATTATCCTCACCACAAACGAAACACGACACGCAATAAGTGCCTTTTCGCCATTCGCCACTCCACATGATATCTAAGATATCAAAAACACATTCCGTCCACCTCCACCTTTTTCCTGCCTATAATTAAAATTTCCTATGTCGCTTGTACTTTGACCATTCCGAAAATGCTTACGTTTACTAGTATTTACCTGCCATATCCGAGCCATATCCGAATAACCACTACCAT

Full Affymetrix probeset data:

Annotations for 1641463_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime