FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641465_at:

>probe:Drosophila_2:1641465_at:197:479; Interrogation_Position=232; Antisense; GTCTTTAAGCCGTACGAGAAGCGCC
>probe:Drosophila_2:1641465_at:316:379; Interrogation_Position=249; Antisense; GAAGCGCCAGGATCTGTCCAAGTAC
>probe:Drosophila_2:1641465_at:412:327; Interrogation_Position=281; Antisense; GCGATGCGGATGAAGAGCTCCTCTT
>probe:Drosophila_2:1641465_at:350:607; Interrogation_Position=363; Antisense; TGATGACTCCCATCCAAACATGGTC
>probe:Drosophila_2:1641465_at:722:231; Interrogation_Position=390; Antisense; AATCTTCAAGAACCGACCCAGGATG
>probe:Drosophila_2:1641465_at:72:547; Interrogation_Position=410; Antisense; GGATGACCTTTGATGATGCCAGAGC
>probe:Drosophila_2:1641465_at:73:111; Interrogation_Position=432; Antisense; AGCAAAGCCCGACCAGGAGTTCCAG
>probe:Drosophila_2:1641465_at:266:447; Interrogation_Position=466; Antisense; GATGCCCGCGGAGAAATCGAGTACT
>probe:Drosophila_2:1641465_at:301:431; Interrogation_Position=484; Antisense; GAGTACTCACCCAAAGTGGTCACCT
>probe:Drosophila_2:1641465_at:630:641; Interrogation_Position=533; Antisense; TCTACTTTCCCAGCAATTTTGGCGA
>probe:Drosophila_2:1641465_at:505:377; Interrogation_Position=604; Antisense; GAAGCTCATTACCATGGCGTAACCA
>probe:Drosophila_2:1641465_at:34:127; Interrogation_Position=625; Antisense; ACCATATGCAACTACGAATCCCGTG
>probe:Drosophila_2:1641465_at:522:169; Interrogation_Position=672; Antisense; AAAGGCTTTCGATGGAGTCGGCAGA
>probe:Drosophila_2:1641465_at:266:499; Interrogation_Position=688; Antisense; GTCGGCAGAGCCATCCAATAGGGTT

Paste this into a BLAST search page for me
GTCTTTAAGCCGTACGAGAAGCGCCGAAGCGCCAGGATCTGTCCAAGTACGCGATGCGGATGAAGAGCTCCTCTTTGATGACTCCCATCCAAACATGGTCAATCTTCAAGAACCGACCCAGGATGGGATGACCTTTGATGATGCCAGAGCAGCAAAGCCCGACCAGGAGTTCCAGGATGCCCGCGGAGAAATCGAGTACTGAGTACTCACCCAAAGTGGTCACCTTCTACTTTCCCAGCAATTTTGGCGAGAAGCTCATTACCATGGCGTAACCAACCATATGCAACTACGAATCCCGTGAAAGGCTTTCGATGGAGTCGGCAGAGTCGGCAGAGCCATCCAATAGGGTT

Full Affymetrix probeset data:

Annotations for 1641465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720