FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641466_at:

>probe:Drosophila_2:1641466_at:699:219; Interrogation_Position=2907; Antisense; AAGTGACTTTGTCCCGACATCCCAT
>probe:Drosophila_2:1641466_at:716:331; Interrogation_Position=2941; Antisense; GCTGTTGACGGTTTGGTTTCGGATT
>probe:Drosophila_2:1641466_at:90:591; Interrogation_Position=2972; Antisense; TGGTTTTTCGAAATCGTGCGCATGA
>probe:Drosophila_2:1641466_at:115:135; Interrogation_Position=3004; Antisense; ACGAATTCTCGATGGTGTTGCGGAT
>probe:Drosophila_2:1641466_at:730:11; Interrogation_Position=3054; Antisense; ATTAAAGTGATATCGGTCGCCGCTG
>probe:Drosophila_2:1641466_at:574:633; Interrogation_Position=3070; Antisense; TCGCCGCTGGCCGTAATAGATTAAC
>probe:Drosophila_2:1641466_at:149:239; Interrogation_Position=3121; Antisense; AATAGACGCCATCCAAATTGAGTTA
>probe:Drosophila_2:1641466_at:197:705; Interrogation_Position=3188; Antisense; TTATGATTAAGCTCGGGTCGCCTGA
>probe:Drosophila_2:1641466_at:668:303; Interrogation_Position=3220; Antisense; CCGACTGGATTGAGCCCTCTTAATG
>probe:Drosophila_2:1641466_at:349:351; Interrogation_Position=3256; Antisense; GCAGCAAACAGCCTTTGCAGCTCAA
>probe:Drosophila_2:1641466_at:79:707; Interrogation_Position=3308; Antisense; TTAAATTCAAGTGACGACCGCCCCT
>probe:Drosophila_2:1641466_at:359:321; Interrogation_Position=3327; Antisense; GCCCCTGCATGTCAAACGCGAGGAG
>probe:Drosophila_2:1641466_at:81:389; Interrogation_Position=3356; Antisense; GAAACTTCCGCCTTTGAGCGAGTCA
>probe:Drosophila_2:1641466_at:452:127; Interrogation_Position=3454; Antisense; ACCAAAGAGTTGACGCCGGGCCAGA

Paste this into a BLAST search page for me
AAGTGACTTTGTCCCGACATCCCATGCTGTTGACGGTTTGGTTTCGGATTTGGTTTTTCGAAATCGTGCGCATGAACGAATTCTCGATGGTGTTGCGGATATTAAAGTGATATCGGTCGCCGCTGTCGCCGCTGGCCGTAATAGATTAACAATAGACGCCATCCAAATTGAGTTATTATGATTAAGCTCGGGTCGCCTGACCGACTGGATTGAGCCCTCTTAATGGCAGCAAACAGCCTTTGCAGCTCAATTAAATTCAAGTGACGACCGCCCCTGCCCCTGCATGTCAAACGCGAGGAGGAAACTTCCGCCTTTGAGCGAGTCAACCAAAGAGTTGACGCCGGGCCAGA

Full Affymetrix probeset data:

Annotations for 1641466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720