FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641469_at:

>probe:Drosophila_2:1641469_at:356:509; Interrogation_Position=1369; Antisense; GTGATTGTCCCGGTCTAGTCTTTCC
>probe:Drosophila_2:1641469_at:54:431; Interrogation_Position=1397; Antisense; GAGTACTCCCAAAAGCCTGCAAGTG
>probe:Drosophila_2:1641469_at:650:271; Interrogation_Position=1439; Antisense; CATATCGCAACTGGCTGTTCCATAC
>probe:Drosophila_2:1641469_at:532:629; Interrogation_Position=1467; Antisense; TCCCTGAAGTTTCTCGGCGAACATC
>probe:Drosophila_2:1641469_at:641:151; Interrogation_Position=1487; Antisense; ACATCTGAATCTACCACAGCTTCTG
>probe:Drosophila_2:1641469_at:346:629; Interrogation_Position=1516; Antisense; TCCACCTGCCCGAGGATTACGATGA
>probe:Drosophila_2:1641469_at:330:315; Interrogation_Position=1554; Antisense; GCCATCTCCGATGCTTGGGCATATA
>probe:Drosophila_2:1641469_at:95:367; Interrogation_Position=1631; Antisense; GAATCATATCCTTCGCATGTGCCTG
>probe:Drosophila_2:1641469_at:73:729; Interrogation_Position=1671; Antisense; TTGGTATTGCAGTTTTATCCGCCCG
>probe:Drosophila_2:1641469_at:722:671; Interrogation_Position=1686; Antisense; TATCCGCCCGGATTTGAGGAGCGAC
>probe:Drosophila_2:1641469_at:528:415; Interrogation_Position=1704; Antisense; GAGCGACGTGAGCACTGGCTCCAAC
>probe:Drosophila_2:1641469_at:585:425; Interrogation_Position=1782; Antisense; GAGAGCGAGACCAACGGCGACACAT
>probe:Drosophila_2:1641469_at:151:559; Interrogation_Position=1850; Antisense; GGACAGCTCCAATGACGAGACCAAT
>probe:Drosophila_2:1641469_at:294:79; Interrogation_Position=1914; Antisense; AGGTCTCGGAACGTGTTTGCTCTGC

Paste this into a BLAST search page for me
GTGATTGTCCCGGTCTAGTCTTTCCGAGTACTCCCAAAAGCCTGCAAGTGCATATCGCAACTGGCTGTTCCATACTCCCTGAAGTTTCTCGGCGAACATCACATCTGAATCTACCACAGCTTCTGTCCACCTGCCCGAGGATTACGATGAGCCATCTCCGATGCTTGGGCATATAGAATCATATCCTTCGCATGTGCCTGTTGGTATTGCAGTTTTATCCGCCCGTATCCGCCCGGATTTGAGGAGCGACGAGCGACGTGAGCACTGGCTCCAACGAGAGCGAGACCAACGGCGACACATGGACAGCTCCAATGACGAGACCAATAGGTCTCGGAACGTGTTTGCTCTGC

Full Affymetrix probeset data:

Annotations for 1641469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720