Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641470_s_at:

>probe:Drosophila_2:1641470_s_at:83:513; Interrogation_Position=159; Antisense; GTGATCGCGGCAAGTGCAGTTCATT
>probe:Drosophila_2:1641470_s_at:27:21; Interrogation_Position=181; Antisense; ATTTGTTTTCCAAGTGCCACATCGC
>probe:Drosophila_2:1641470_s_at:372:95; Interrogation_Position=233; Antisense; AGATTTCCGCGGATGCTGCAATTGC
>probe:Drosophila_2:1641470_s_at:387:9; Interrogation_Position=253; Antisense; ATTGCCAAAATAGTGCCGTTCTCCA
>probe:Drosophila_2:1641470_s_at:350:37; Interrogation_Position=277; Antisense; ATCTCATTTTCGCTCGCTGGCTATC
>probe:Drosophila_2:1641470_s_at:353:227; Interrogation_Position=328; Antisense; AATCGGGCCGCCAAGAATTTATGGA
>probe:Drosophila_2:1641470_s_at:675:363; Interrogation_Position=351; Antisense; GAATTCGGCATTTTGTGGATTTAGC
>probe:Drosophila_2:1641470_s_at:178:433; Interrogation_Position=391; Antisense; GAGTGCGCCGACCAAATGTTTGCTG
>probe:Drosophila_2:1641470_s_at:70:603; Interrogation_Position=407; Antisense; TGTTTGCTGCTCGTTTTCGGTTAAA
>probe:Drosophila_2:1641470_s_at:587:319; Interrogation_Position=445; Antisense; GCCGCTGCGCCAAAATCTCAAGAAT
>probe:Drosophila_2:1641470_s_at:616:363; Interrogation_Position=466; Antisense; GAATTCACGTGCGAATTCCCCAGCG
>probe:Drosophila_2:1641470_s_at:397:631; Interrogation_Position=482; Antisense; TCCCCAGCGCGTATCACTTTAATTA
>probe:Drosophila_2:1641470_s_at:578:251; Interrogation_Position=678; Antisense; CAAGTGTTGGCAATTCTTCGTCGGA
>probe:Drosophila_2:1641470_s_at:104:393; Interrogation_Position=719; Antisense; GAAATTGACGTTCCAACGCCAAAGG

Paste this into a BLAST search page for me
GTGATCGCGGCAAGTGCAGTTCATTATTTGTTTTCCAAGTGCCACATCGCAGATTTCCGCGGATGCTGCAATTGCATTGCCAAAATAGTGCCGTTCTCCAATCTCATTTTCGCTCGCTGGCTATCAATCGGGCCGCCAAGAATTTATGGAGAATTCGGCATTTTGTGGATTTAGCGAGTGCGCCGACCAAATGTTTGCTGTGTTTGCTGCTCGTTTTCGGTTAAAGCCGCTGCGCCAAAATCTCAAGAATGAATTCACGTGCGAATTCCCCAGCGTCCCCAGCGCGTATCACTTTAATTACAAGTGTTGGCAATTCTTCGTCGGAGAAATTGACGTTCCAACGCCAAAGG

Full Affymetrix probeset data:

Annotations for 1641470_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime