FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641471_at:

>probe:Drosophila_2:1641471_at:99:615; Interrogation_Position=1017; Antisense; TGAAGCTAAATTTCACGCCTCCTTA
>probe:Drosophila_2:1641471_at:167:541; Interrogation_Position=1107; Antisense; GGTTGCTTCTGGATATCTTTGGTTG
>probe:Drosophila_2:1641471_at:391:567; Interrogation_Position=616; Antisense; GGCAGCTGGAGTTTGGTACCACAAT
>probe:Drosophila_2:1641471_at:420:223; Interrogation_Position=645; Antisense; AAGGTGCTCTGTGCATTTGTCTTGT
>probe:Drosophila_2:1641471_at:485:19; Interrogation_Position=659; Antisense; ATTTGTCTTGTACCGCACCTTAGAA
>probe:Drosophila_2:1641471_at:121:119; Interrogation_Position=727; Antisense; AGCTGCATCTGATCCATACTTTGGC
>probe:Drosophila_2:1641471_at:621:29; Interrogation_Position=742; Antisense; ATACTTTGGCCAGGGTTGTGCACCA
>probe:Drosophila_2:1641471_at:600:553; Interrogation_Position=782; Antisense; GGAGCCTAGGGTCCTTAAACATGTA
>probe:Drosophila_2:1641471_at:665:655; Interrogation_Position=808; Antisense; TAAGGATCTATTCTCGTCTGGCTGA
>probe:Drosophila_2:1641471_at:647:453; Interrogation_Position=831; Antisense; GATCATCCCCAAAATCTGGAGCTGA
>probe:Drosophila_2:1641471_at:603:605; Interrogation_Position=853; Antisense; TGATCCTTAAGCTATTGCCGGCTCA
>probe:Drosophila_2:1641471_at:414:477; Interrogation_Position=907; Antisense; GTTTAGTGGGCTTCGAGAGCGCTTC
>probe:Drosophila_2:1641471_at:431:417; Interrogation_Position=923; Antisense; GAGCGCTTCTCTAGAGCTAGCTGAT
>probe:Drosophila_2:1641471_at:417:447; Interrogation_Position=996; Antisense; GATGCCATGCCGGAAAACCATTGAA

Paste this into a BLAST search page for me
TGAAGCTAAATTTCACGCCTCCTTAGGTTGCTTCTGGATATCTTTGGTTGGGCAGCTGGAGTTTGGTACCACAATAAGGTGCTCTGTGCATTTGTCTTGTATTTGTCTTGTACCGCACCTTAGAAAGCTGCATCTGATCCATACTTTGGCATACTTTGGCCAGGGTTGTGCACCAGGAGCCTAGGGTCCTTAAACATGTATAAGGATCTATTCTCGTCTGGCTGAGATCATCCCCAAAATCTGGAGCTGATGATCCTTAAGCTATTGCCGGCTCAGTTTAGTGGGCTTCGAGAGCGCTTCGAGCGCTTCTCTAGAGCTAGCTGATGATGCCATGCCGGAAAACCATTGAA

Full Affymetrix probeset data:

Annotations for 1641471_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720