Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641472_at:

>probe:Drosophila_2:1641472_at:601:291; Interrogation_Position=122; Antisense; CGTGCTCTGCCTTATTGTGTTGAGT
>probe:Drosophila_2:1641472_at:399:93; Interrogation_Position=167; Antisense; AGATCTCTTCTGTTGGTTTGAAACG
>probe:Drosophila_2:1641472_at:702:9; Interrogation_Position=207; Antisense; ATTCCGCTGACCGTTTTGATGTACA
>probe:Drosophila_2:1641472_at:15:223; Interrogation_Position=243; Antisense; AAGGTGGCTATTATCCTGTTTCTCG
>probe:Drosophila_2:1641472_at:136:681; Interrogation_Position=317; Antisense; TATGGACATGCCCATCTCTTACGTT
>probe:Drosophila_2:1641472_at:657:205; Interrogation_Position=345; Antisense; AAGCGGTACTGTCGTTTTCTTGTGA
>probe:Drosophila_2:1641472_at:510:445; Interrogation_Position=368; Antisense; GATGAACCTGTTGGCGTCCGTAGAC
>probe:Drosophila_2:1641472_at:88:147; Interrogation_Position=409; Antisense; ACTCACACATTGATGACTTCCTGCA
>probe:Drosophila_2:1641472_at:486:545; Interrogation_Position=503; Antisense; GGATCTGCAACTTTGTGTTCCACTC
>probe:Drosophila_2:1641472_at:516:217; Interrogation_Position=532; Antisense; AAGTCCTTTCTGTGGATGATCCGCA
>probe:Drosophila_2:1641472_at:529:393; Interrogation_Position=558; Antisense; GAGAAGGAACTCCTCCGCTTGGGTT
>probe:Drosophila_2:1641472_at:16:95; Interrogation_Position=601; Antisense; AGTTGCGAGAGCTGGACGTCTACAA
>probe:Drosophila_2:1641472_at:512:333; Interrogation_Position=64; Antisense; GCTGGAGCAGAGTTCTTCGGCTGAT
>probe:Drosophila_2:1641472_at:325:463; Interrogation_Position=86; Antisense; GATTCGGTTGCATCATCTGGCGGTG

Paste this into a BLAST search page for me
CGTGCTCTGCCTTATTGTGTTGAGTAGATCTCTTCTGTTGGTTTGAAACGATTCCGCTGACCGTTTTGATGTACAAAGGTGGCTATTATCCTGTTTCTCGTATGGACATGCCCATCTCTTACGTTAAGCGGTACTGTCGTTTTCTTGTGAGATGAACCTGTTGGCGTCCGTAGACACTCACACATTGATGACTTCCTGCAGGATCTGCAACTTTGTGTTCCACTCAAGTCCTTTCTGTGGATGATCCGCAGAGAAGGAACTCCTCCGCTTGGGTTAGTTGCGAGAGCTGGACGTCTACAAGCTGGAGCAGAGTTCTTCGGCTGATGATTCGGTTGCATCATCTGGCGGTG

Full Affymetrix probeset data:

Annotations for 1641472_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime