Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641473_at:

>probe:Drosophila_2:1641473_at:693:97; Interrogation_Position=1921; Antisense; AGAGATTGCCCGCTTTTGCCGCGGC
>probe:Drosophila_2:1641473_at:71:701; Interrogation_Position=1934; Antisense; TTTTGCCGCGGCAATTTTAAGGCGT
>probe:Drosophila_2:1641473_at:574:327; Interrogation_Position=1941; Antisense; GCGGCAATTTTAAGGCGTTTCAATG
>probe:Drosophila_2:1641473_at:354:237; Interrogation_Position=1961; Antisense; CAATGAAAAGGATTCGCGGAAGTAC
>probe:Drosophila_2:1641473_at:658:541; Interrogation_Position=1970; Antisense; GGATTCGCGGAAGTACAAGGATAAT
>probe:Drosophila_2:1641473_at:546:249; Interrogation_Position=1985; Antisense; CAAGGATAATCAGGAGTCGTTGAAT
>probe:Drosophila_2:1641473_at:259:709; Interrogation_Position=2004; Antisense; TTGAATATTGTGGAGGGAAGCGTAC
>probe:Drosophila_2:1641473_at:278:207; Interrogation_Position=2021; Antisense; AAGCGTACAGGAGATTCCAGCGACC
>probe:Drosophila_2:1641473_at:104:263; Interrogation_Position=2038; Antisense; CAGCGACCAATAATGCCATCGATGG
>probe:Drosophila_2:1641473_at:602:313; Interrogation_Position=2052; Antisense; GCCATCGATGGCAATGACAATGAAC
>probe:Drosophila_2:1641473_at:716:395; Interrogation_Position=2067; Antisense; GACAATGAACCAAAGGCTATAGTTT
>probe:Drosophila_2:1641473_at:654:277; Interrogation_Position=2083; Antisense; CTATAGTTTGGCAGAGCACCTCACC
>probe:Drosophila_2:1641473_at:79:351; Interrogation_Position=2093; Antisense; GCAGAGCACCTCACCAGTGTGGACA
>probe:Drosophila_2:1641473_at:707:259; Interrogation_Position=2104; Antisense; CACCAGTGTGGACATTTAAGTAAAG

Paste this into a BLAST search page for me
AGAGATTGCCCGCTTTTGCCGCGGCTTTTGCCGCGGCAATTTTAAGGCGTGCGGCAATTTTAAGGCGTTTCAATGCAATGAAAAGGATTCGCGGAAGTACGGATTCGCGGAAGTACAAGGATAATCAAGGATAATCAGGAGTCGTTGAATTTGAATATTGTGGAGGGAAGCGTACAAGCGTACAGGAGATTCCAGCGACCCAGCGACCAATAATGCCATCGATGGGCCATCGATGGCAATGACAATGAACGACAATGAACCAAAGGCTATAGTTTCTATAGTTTGGCAGAGCACCTCACCGCAGAGCACCTCACCAGTGTGGACACACCAGTGTGGACATTTAAGTAAAG

Full Affymetrix probeset data:

Annotations for 1641473_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime