Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641474_s_at:

>probe:Drosophila_2:1641474_s_at:584:83; Interrogation_Position=361; Antisense; AGTGGCTCACAGTGGCGTCTACACT
>probe:Drosophila_2:1641474_s_at:97:353; Interrogation_Position=464; Antisense; GCACCCGGAACCTTGTAAGGAGTAT
>probe:Drosophila_2:1641474_s_at:257:491; Interrogation_Position=478; Antisense; GTAAGGAGTATACCGCCTTCAATCC
>probe:Drosophila_2:1641474_s_at:421:233; Interrogation_Position=498; Antisense; AATCCCTTTGTCGATCGGACCATTG
>probe:Drosophila_2:1641474_s_at:158:643; Interrogation_Position=525; Antisense; TCTGCCACGGATACTGCCATTGATG
>probe:Drosophila_2:1641474_s_at:679:697; Interrogation_Position=562; Antisense; TTTAGACCCCTCAACACGTTATGTA
>probe:Drosophila_2:1641474_s_at:526:685; Interrogation_Position=610; Antisense; TATAGACAGGGTACTCGCACCTAGC
>probe:Drosophila_2:1641474_s_at:306:447; Interrogation_Position=645; Antisense; GATCCTTTCATACCTGTCCCGAAAA
>probe:Drosophila_2:1641474_s_at:663:643; Interrogation_Position=677; Antisense; TCATCAAAATTCTCTTCCGACCTAA
>probe:Drosophila_2:1641474_s_at:202:139; Interrogation_Position=712; Antisense; ACGTTTGTGGTTGCCTATTTCTCTC
>probe:Drosophila_2:1641474_s_at:269:689; Interrogation_Position=727; Antisense; TATTTCTCTCGCTTACCTATTTATT
>probe:Drosophila_2:1641474_s_at:593:345; Interrogation_Position=754; Antisense; GCATACATTTTCCAAGCATCCTGTG
>probe:Drosophila_2:1641474_s_at:662:199; Interrogation_Position=783; Antisense; AACCATCACAAGTTTTCTTCGAACG
>probe:Drosophila_2:1641474_s_at:622:645; Interrogation_Position=798; Antisense; TCTTCGAACGGAATGCCAAGTGCAT

Paste this into a BLAST search page for me
AGTGGCTCACAGTGGCGTCTACACTGCACCCGGAACCTTGTAAGGAGTATGTAAGGAGTATACCGCCTTCAATCCAATCCCTTTGTCGATCGGACCATTGTCTGCCACGGATACTGCCATTGATGTTTAGACCCCTCAACACGTTATGTATATAGACAGGGTACTCGCACCTAGCGATCCTTTCATACCTGTCCCGAAAATCATCAAAATTCTCTTCCGACCTAAACGTTTGTGGTTGCCTATTTCTCTCTATTTCTCTCGCTTACCTATTTATTGCATACATTTTCCAAGCATCCTGTGAACCATCACAAGTTTTCTTCGAACGTCTTCGAACGGAATGCCAAGTGCAT

Full Affymetrix probeset data:

Annotations for 1641474_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime