FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641475_at:

>probe:Drosophila_2:1641475_at:529:483; Interrogation_Position=2608; Antisense; GTATAACCACTCACGAATAGCTCAA
>probe:Drosophila_2:1641475_at:340:363; Interrogation_Position=2622; Antisense; GAATAGCTCAAACCGAACGCAATAA
>probe:Drosophila_2:1641475_at:194:357; Interrogation_Position=2647; Antisense; GCACTACAGGTGTATCTAGCGGCAC
>probe:Drosophila_2:1641475_at:301:643; Interrogation_Position=2661; Antisense; TCTAGCGGCACTACCTTTAAAGGCA
>probe:Drosophila_2:1641475_at:646:551; Interrogation_Position=2695; Antisense; GGAGACCCCGATGAAAGCATAGCTT
>probe:Drosophila_2:1641475_at:661:345; Interrogation_Position=2711; Antisense; GCATAGCTTAACGAAGACACCGAAT
>probe:Drosophila_2:1641475_at:199:399; Interrogation_Position=2726; Antisense; GACACCGAATCATTATCCACTACTG
>probe:Drosophila_2:1641475_at:191:37; Interrogation_Position=2789; Antisense; ATCTATATAGACATCAGCCCGCTTC
>probe:Drosophila_2:1641475_at:45:125; Interrogation_Position=2804; Antisense; AGCCCGCTTCTACGTATATTTTGTA
>probe:Drosophila_2:1641475_at:39:365; Interrogation_Position=2858; Antisense; GAATAACTACGTGCATACAACCATA
>probe:Drosophila_2:1641475_at:15:663; Interrogation_Position=2891; Antisense; TACAAGCATACATAGCGATTCGCGA
>probe:Drosophila_2:1641475_at:136:457; Interrogation_Position=2924; Antisense; GATACAACTTCAATTCGTGTCCAAT
>probe:Drosophila_2:1641475_at:326:507; Interrogation_Position=2940; Antisense; GTGTCCAATCAAAACTTCAATTCGT
>probe:Drosophila_2:1641475_at:137:151; Interrogation_Position=2999; Antisense; AAAGAGTTTGTGCAGAGGAACCCAA

Paste this into a BLAST search page for me
GTATAACCACTCACGAATAGCTCAAGAATAGCTCAAACCGAACGCAATAAGCACTACAGGTGTATCTAGCGGCACTCTAGCGGCACTACCTTTAAAGGCAGGAGACCCCGATGAAAGCATAGCTTGCATAGCTTAACGAAGACACCGAATGACACCGAATCATTATCCACTACTGATCTATATAGACATCAGCCCGCTTCAGCCCGCTTCTACGTATATTTTGTAGAATAACTACGTGCATACAACCATATACAAGCATACATAGCGATTCGCGAGATACAACTTCAATTCGTGTCCAATGTGTCCAATCAAAACTTCAATTCGTAAAGAGTTTGTGCAGAGGAACCCAA

Full Affymetrix probeset data:

Annotations for 1641475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720