FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641477_at:

>probe:Drosophila_2:1641477_at:552:9; Interrogation_Position=2548; Antisense; ATTCCTATCGGTCGGTCAGAGGGTT
>probe:Drosophila_2:1641477_at:289:469; Interrogation_Position=2570; Antisense; GTTCGTGGAAGTTCGTGGATCTGCA
>probe:Drosophila_2:1641477_at:15:363; Interrogation_Position=2620; Antisense; GCAATATCGACCATCTACACTGGTT
>probe:Drosophila_2:1641477_at:380:287; Interrogation_Position=2639; Antisense; CTGGTTACATTTTACACACTCGCTG
>probe:Drosophila_2:1641477_at:679:157; Interrogation_Position=2654; Antisense; ACACTCGCTGTAGCAACGATTCTAT
>probe:Drosophila_2:1641477_at:635:503; Interrogation_Position=2686; Antisense; GTCCTTGAAGGCCTTGCGATTCTTA
>probe:Drosophila_2:1641477_at:402:27; Interrogation_Position=2718; Antisense; ATACCGAGTTATTTCTGGCTTGTGA
>probe:Drosophila_2:1641477_at:115:191; Interrogation_Position=2845; Antisense; AACTTGGCTCGAATTTGCGTTAAGA
>probe:Drosophila_2:1641477_at:609:507; Interrogation_Position=2894; Antisense; GTGAGAAGTCCCTGGAATCCACCTG
>probe:Drosophila_2:1641477_at:470:411; Interrogation_Position=2918; Antisense; GACGCTCGTCGAGTATATTTGTACA
>probe:Drosophila_2:1641477_at:375:49; Interrogation_Position=2944; Antisense; ATGTTTTGCCCCTGTGAACACACAT
>probe:Drosophila_2:1641477_at:634:709; Interrogation_Position=2994; Antisense; TTAATACCCATTTGACTAGCCAAGT
>probe:Drosophila_2:1641477_at:360:727; Interrogation_Position=3048; Antisense; TTGTACATACTGCAATGGCCCCGAG
>probe:Drosophila_2:1641477_at:256:159; Interrogation_Position=3083; Antisense; ACACACTCGGTGAGCAAGCCAATCT

Paste this into a BLAST search page for me
ATTCCTATCGGTCGGTCAGAGGGTTGTTCGTGGAAGTTCGTGGATCTGCAGCAATATCGACCATCTACACTGGTTCTGGTTACATTTTACACACTCGCTGACACTCGCTGTAGCAACGATTCTATGTCCTTGAAGGCCTTGCGATTCTTAATACCGAGTTATTTCTGGCTTGTGAAACTTGGCTCGAATTTGCGTTAAGAGTGAGAAGTCCCTGGAATCCACCTGGACGCTCGTCGAGTATATTTGTACAATGTTTTGCCCCTGTGAACACACATTTAATACCCATTTGACTAGCCAAGTTTGTACATACTGCAATGGCCCCGAGACACACTCGGTGAGCAAGCCAATCT

Full Affymetrix probeset data:

Annotations for 1641477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720