FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641479_at:

>probe:Drosophila_2:1641479_at:213:277; Interrogation_Position=131; Antisense; CTTTGGAGGACGTGGTCCAGGATTC
>probe:Drosophila_2:1641479_at:330:627; Interrogation_Position=146; Antisense; TCCAGGATTCGGTCGTGGCGGTTTC
>probe:Drosophila_2:1641479_at:11:1; Interrogation_Position=188; Antisense; AGGCTTTAGAGGAGGCGGCTTTCGA
>probe:Drosophila_2:1641479_at:61:277; Interrogation_Position=206; Antisense; CTTTCGAGGCTATGGAGGATATGGC
>probe:Drosophila_2:1641479_at:568:329; Interrogation_Position=238; Antisense; GCGGATATGCCCGATATGGCGGCTA
>probe:Drosophila_2:1641479_at:60:459; Interrogation_Position=250; Antisense; GATATGGCGGCTACGCTGGATACGC
>probe:Drosophila_2:1641479_at:429:337; Interrogation_Position=259; Antisense; GCTACGCTGGATACGCGGGAGTTCT
>probe:Drosophila_2:1641479_at:496:293; Interrogation_Position=266; Antisense; TGGATACGCGGGAGTTCTTCCGGTT
>probe:Drosophila_2:1641479_at:91:685; Interrogation_Position=306; Antisense; TATCCCGCAACCTATAATCGCTGCT
>probe:Drosophila_2:1641479_at:16:361; Interrogation_Position=312; Antisense; GCAACCTATAATCGCTGCTACTACG
>probe:Drosophila_2:1641479_at:237:297; Interrogation_Position=324; Antisense; CGCTGCTACTACGATAATTACTATT
>probe:Drosophila_2:1641479_at:280:277; Interrogation_Position=344; Antisense; CTATTATAATTACTACTACTGCTGA
>probe:Drosophila_2:1641479_at:519:147; Interrogation_Position=358; Antisense; ACTACTGCTGATATGATACGGTTAT
>probe:Drosophila_2:1641479_at:500:71; Interrogation_Position=50; Antisense; AGGCGGTCATGCTGGAGGTTTCGGA

Paste this into a BLAST search page for me
CTTTGGAGGACGTGGTCCAGGATTCTCCAGGATTCGGTCGTGGCGGTTTCAGGCTTTAGAGGAGGCGGCTTTCGACTTTCGAGGCTATGGAGGATATGGCGCGGATATGCCCGATATGGCGGCTAGATATGGCGGCTACGCTGGATACGCGCTACGCTGGATACGCGGGAGTTCTTGGATACGCGGGAGTTCTTCCGGTTTATCCCGCAACCTATAATCGCTGCTGCAACCTATAATCGCTGCTACTACGCGCTGCTACTACGATAATTACTATTCTATTATAATTACTACTACTGCTGAACTACTGCTGATATGATACGGTTATAGGCGGTCATGCTGGAGGTTTCGGA

Full Affymetrix probeset data:

Annotations for 1641479_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720