Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641481_at:

>probe:Drosophila_2:1641481_at:649:241; Interrogation_Position=1152; Antisense; CAAGAAATGGTATCCCCAGCCGGAT
>probe:Drosophila_2:1641481_at:584:577; Interrogation_Position=1182; Antisense; GGCCCATCCGAATGTGAAGTTGTTC
>probe:Drosophila_2:1641481_at:134:217; Interrogation_Position=1198; Antisense; AAGTTGTTCATCAGCCACGGTGGTC
>probe:Drosophila_2:1641481_at:16:607; Interrogation_Position=1226; Antisense; TGAGCAGCACCGAAAGCGTTTACTT
>probe:Drosophila_2:1641481_at:453:707; Interrogation_Position=1245; Antisense; TTACTTTGGCAAACCCATACTGGGA
>probe:Drosophila_2:1641481_at:612:271; Interrogation_Position=1260; Antisense; CATACTGGGATTGCCGTGCTTCTAT
>probe:Drosophila_2:1641481_at:409:153; Interrogation_Position=1292; Antisense; ACATGAATGTGCAGCGCGCCCAGCG
>probe:Drosophila_2:1641481_at:449:227; Interrogation_Position=1372; Antisense; AAGGCCATTCAAACGCTGCTCACTG
>probe:Drosophila_2:1641481_at:216:143; Interrogation_Position=1393; Antisense; ACTGATCCCAGTTATGCCAAAGCAT
>probe:Drosophila_2:1641481_at:511:45; Interrogation_Position=1416; Antisense; ATCCTTGGCCATTTCCGAGCGGTAT
>probe:Drosophila_2:1641481_at:562:407; Interrogation_Position=1482; Antisense; GACGGAGTACGTAATCAGGCACAAT
>probe:Drosophila_2:1641481_at:54:291; Interrogation_Position=1534; Antisense; CGGGATCTCAACTTCATTCAACTGA
>probe:Drosophila_2:1641481_at:317:605; Interrogation_Position=1580; Antisense; TGATACTGGCAGTACCTCTACTACT
>probe:Drosophila_2:1641481_at:613:643; Interrogation_Position=1596; Antisense; TCTACTACTCGCTCTGTTAATCGTA

Paste this into a BLAST search page for me
CAAGAAATGGTATCCCCAGCCGGATGGCCCATCCGAATGTGAAGTTGTTCAAGTTGTTCATCAGCCACGGTGGTCTGAGCAGCACCGAAAGCGTTTACTTTTACTTTGGCAAACCCATACTGGGACATACTGGGATTGCCGTGCTTCTATACATGAATGTGCAGCGCGCCCAGCGAAGGCCATTCAAACGCTGCTCACTGACTGATCCCAGTTATGCCAAAGCATATCCTTGGCCATTTCCGAGCGGTATGACGGAGTACGTAATCAGGCACAATCGGGATCTCAACTTCATTCAACTGATGATACTGGCAGTACCTCTACTACTTCTACTACTCGCTCTGTTAATCGTA

Full Affymetrix probeset data:

Annotations for 1641481_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime