FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641483_at:

>probe:Drosophila_2:1641483_at:6:139; Interrogation_Position=1350; Antisense; ACGAGGAGGACTACAATCTGCAGCA
>probe:Drosophila_2:1641483_at:193:73; Interrogation_Position=1530; Antisense; AGGACGAGAGCCGACTGATTGATGA
>probe:Drosophila_2:1641483_at:454:617; Interrogation_Position=1563; Antisense; TGCAGCACAGCGACCACAGTAACAG
>probe:Drosophila_2:1641483_at:282:187; Interrogation_Position=1583; Antisense; AACAGCCACTCGAAGGAGTTCGCCA
>probe:Drosophila_2:1641483_at:517:469; Interrogation_Position=1600; Antisense; GTTCGCCATCAGCTACGATAACAAC
>probe:Drosophila_2:1641483_at:633:23; Interrogation_Position=1626; Antisense; ATAACAAACGGGAGGCCAGCGGCCA
>probe:Drosophila_2:1641483_at:369:105; Interrogation_Position=1665; Antisense; AGACGGCGCAGTTGATTGGCCACAA
>probe:Drosophila_2:1641483_at:726:627; Interrogation_Position=1755; Antisense; TGCCAGCGCCCGTGGATCTGAAGAA
>probe:Drosophila_2:1641483_at:80:27; Interrogation_Position=1784; Antisense; ATACTCGGGACTGCGACTTCATTAA
>probe:Drosophila_2:1641483_at:518:709; Interrogation_Position=1805; Antisense; TTAACACGCCTTAATCCTTGGATAT
>probe:Drosophila_2:1641483_at:26:545; Interrogation_Position=1824; Antisense; GGATATCAGCCTGTGATCTGGCACA
>probe:Drosophila_2:1641483_at:633:565; Interrogation_Position=1853; Antisense; GGCACAGGAACCGACTTGCAGTCAT
>probe:Drosophila_2:1641483_at:289:497; Interrogation_Position=1873; Antisense; GTCATCATCTGGGATTTCTGTGTCC
>probe:Drosophila_2:1641483_at:90:307; Interrogation_Position=1897; Antisense; CCTGTGTCTCTCGAAAACTCTTTAT

Paste this into a BLAST search page for me
ACGAGGAGGACTACAATCTGCAGCAAGGACGAGAGCCGACTGATTGATGATGCAGCACAGCGACCACAGTAACAGAACAGCCACTCGAAGGAGTTCGCCAGTTCGCCATCAGCTACGATAACAACATAACAAACGGGAGGCCAGCGGCCAAGACGGCGCAGTTGATTGGCCACAATGCCAGCGCCCGTGGATCTGAAGAAATACTCGGGACTGCGACTTCATTAATTAACACGCCTTAATCCTTGGATATGGATATCAGCCTGTGATCTGGCACAGGCACAGGAACCGACTTGCAGTCATGTCATCATCTGGGATTTCTGTGTCCCCTGTGTCTCTCGAAAACTCTTTAT

Full Affymetrix probeset data:

Annotations for 1641483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720