FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641485_at:

>probe:Drosophila_2:1641485_at:459:3; Interrogation_Position=1014; Antisense; ATTGTAGCCAACCTGATTTGACTTG
>probe:Drosophila_2:1641485_at:337:637; Interrogation_Position=1059; Antisense; TCGGTGAACCGAATGCATACTTTTT
>probe:Drosophila_2:1641485_at:190:653; Interrogation_Position=1085; Antisense; TAATTACCACTTTCTATTCTTCGGA
>probe:Drosophila_2:1641485_at:398:497; Interrogation_Position=1157; Antisense; GTCATCATACATTAGGCGGAGCTCC
>probe:Drosophila_2:1641485_at:61:41; Interrogation_Position=592; Antisense; ATCTGTTCCAGACTGAGCCGTCGGG
>probe:Drosophila_2:1641485_at:15:107; Interrogation_Position=629; Antisense; GTATAAGGCTAACGCCACCGGGCGA
>probe:Drosophila_2:1641485_at:358:567; Interrogation_Position=656; Antisense; GGCAAAGGTTGTGCGCGAGTTCTTC
>probe:Drosophila_2:1641485_at:481:91; Interrogation_Position=673; Antisense; AGTTCTTCGAGAAGTCCTACCGCGA
>probe:Drosophila_2:1641485_at:494:393; Interrogation_Position=825; Antisense; GACACCGATGTCATTACCGATTATG
>probe:Drosophila_2:1641485_at:511:263; Interrogation_Position=916; Antisense; CAGCTGGGACACTTCTTCGATGGAA
>probe:Drosophila_2:1641485_at:196:371; Interrogation_Position=938; Antisense; GAAGGCCGTTGCATTGAATCGCTTT
>probe:Drosophila_2:1641485_at:662:5; Interrogation_Position=950; Antisense; ATTGAATCGCTTTCCATGCATTCGG
>probe:Drosophila_2:1641485_at:346:53; Interrogation_Position=965; Antisense; ATGCATTCGGCGACACTATCTGGTG
>probe:Drosophila_2:1641485_at:157:151; Interrogation_Position=999; Antisense; ACATTCTGTCTGCTCATTGTAGCCA

Paste this into a BLAST search page for me
ATTGTAGCCAACCTGATTTGACTTGTCGGTGAACCGAATGCATACTTTTTTAATTACCACTTTCTATTCTTCGGAGTCATCATACATTAGGCGGAGCTCCATCTGTTCCAGACTGAGCCGTCGGGGTATAAGGCTAACGCCACCGGGCGAGGCAAAGGTTGTGCGCGAGTTCTTCAGTTCTTCGAGAAGTCCTACCGCGAGACACCGATGTCATTACCGATTATGCAGCTGGGACACTTCTTCGATGGAAGAAGGCCGTTGCATTGAATCGCTTTATTGAATCGCTTTCCATGCATTCGGATGCATTCGGCGACACTATCTGGTGACATTCTGTCTGCTCATTGTAGCCA

Full Affymetrix probeset data:

Annotations for 1641485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720