Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641486_at:

>probe:Drosophila_2:1641486_at:313:257; Interrogation_Position=1117; Antisense; CACAGGACCCTTGATGGAACCCTAA
>probe:Drosophila_2:1641486_at:538:239; Interrogation_Position=1177; Antisense; AATCACATGGTGTTCGTAACGGACA
>probe:Drosophila_2:1641486_at:350:575; Interrogation_Position=1204; Antisense; GGCGATTTGGTGTTCCTGGATGTAC
>probe:Drosophila_2:1641486_at:470:487; Interrogation_Position=1225; Antisense; GTACGAAATCTTAACTGTGGCCCTG
>probe:Drosophila_2:1641486_at:397:595; Interrogation_Position=1240; Antisense; TGTGGCCCTGCGCTGCTGAAATCAA
>probe:Drosophila_2:1641486_at:36:165; Interrogation_Position=1258; Antisense; AAATCAACGGTCAACTCACGTGCCG
>probe:Drosophila_2:1641486_at:249:429; Interrogation_Position=1294; Antisense; GAGTTGCATCACTTAGGCTCATCTG
>probe:Drosophila_2:1641486_at:239:713; Interrogation_Position=1354; Antisense; TTCGTCCGGGACTATGGGTTGCAAA
>probe:Drosophila_2:1641486_at:346:529; Interrogation_Position=1369; Antisense; GGGTTGCAAATCAATCCGCTGGTCC
>probe:Drosophila_2:1641486_at:611:219; Interrogation_Position=1411; Antisense; AAGTCCACATATCTGAGCGCCAAAC
>probe:Drosophila_2:1641486_at:495:181; Interrogation_Position=1445; Antisense; AAAACATACACTCCCTGGCAATGAC
>probe:Drosophila_2:1641486_at:444:413; Interrogation_Position=1467; Antisense; GACCAGGTTCAATTGCGTTCGTTGC
>probe:Drosophila_2:1641486_at:690:467; Interrogation_Position=1487; Antisense; GTTGCAATTGGAATTCACCCACCCA
>probe:Drosophila_2:1641486_at:311:385; Interrogation_Position=1534; Antisense; GAACATGGCATGTTGCGAATCCTCA

Paste this into a BLAST search page for me
CACAGGACCCTTGATGGAACCCTAAAATCACATGGTGTTCGTAACGGACAGGCGATTTGGTGTTCCTGGATGTACGTACGAAATCTTAACTGTGGCCCTGTGTGGCCCTGCGCTGCTGAAATCAAAAATCAACGGTCAACTCACGTGCCGGAGTTGCATCACTTAGGCTCATCTGTTCGTCCGGGACTATGGGTTGCAAAGGGTTGCAAATCAATCCGCTGGTCCAAGTCCACATATCTGAGCGCCAAACAAAACATACACTCCCTGGCAATGACGACCAGGTTCAATTGCGTTCGTTGCGTTGCAATTGGAATTCACCCACCCAGAACATGGCATGTTGCGAATCCTCA

Full Affymetrix probeset data:

Annotations for 1641486_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime