Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641488_at:

>probe:Drosophila_2:1641488_at:658:519; Interrogation_Position=1042; Antisense; GTGGCGCACGATGTTTACGAACCTG
>probe:Drosophila_2:1641488_at:199:137; Interrogation_Position=1058; Antisense; ACGAACCTGGTCAGTTGTGCTACAC
>probe:Drosophila_2:1641488_at:573:339; Interrogation_Position=1076; Antisense; GCTACACCCGAATTGTGCAGCACTT
>probe:Drosophila_2:1641488_at:316:113; Interrogation_Position=1094; Antisense; AGCACTTCGGACAGGGTATTGTTTC
>probe:Drosophila_2:1641488_at:477:635; Interrogation_Position=1128; Antisense; TCGCATCGATCGGTCCAAGCTGGGA
>probe:Drosophila_2:1641488_at:724:115; Interrogation_Position=1145; Antisense; AGCTGGGACCCTTGGTGTTTGCCGA
>probe:Drosophila_2:1641488_at:236:359; Interrogation_Position=1182; Antisense; GCAAGCACTCAACGGCATTGTCTGG
>probe:Drosophila_2:1641488_at:114:715; Interrogation_Position=1199; Antisense; TTGTCTGGCCGGAACTTATTGCGGA
>probe:Drosophila_2:1641488_at:24:709; Interrogation_Position=1226; Antisense; TTAACAGGCGGCTGGATGCACTGCG
>probe:Drosophila_2:1641488_at:576:535; Interrogation_Position=1337; Antisense; GGTCCATGATTGTGCCACCGGATGA
>probe:Drosophila_2:1641488_at:716:533; Interrogation_Position=1431; Antisense; GGTGCCCAATTCTGAGATCGTGGCC
>probe:Drosophila_2:1641488_at:490:639; Interrogation_Position=1448; Antisense; TCGTGGCCAAGTCGCATGTGATATT
>probe:Drosophila_2:1641488_at:315:21; Interrogation_Position=1468; Antisense; ATATTCAGTTCGCAATGGGATCACG
>probe:Drosophila_2:1641488_at:699:555; Interrogation_Position=1545; Antisense; GGACTCTTACCAGAGCAGCCTTTAA

Paste this into a BLAST search page for me
GTGGCGCACGATGTTTACGAACCTGACGAACCTGGTCAGTTGTGCTACACGCTACACCCGAATTGTGCAGCACTTAGCACTTCGGACAGGGTATTGTTTCTCGCATCGATCGGTCCAAGCTGGGAAGCTGGGACCCTTGGTGTTTGCCGAGCAAGCACTCAACGGCATTGTCTGGTTGTCTGGCCGGAACTTATTGCGGATTAACAGGCGGCTGGATGCACTGCGGGTCCATGATTGTGCCACCGGATGAGGTGCCCAATTCTGAGATCGTGGCCTCGTGGCCAAGTCGCATGTGATATTATATTCAGTTCGCAATGGGATCACGGGACTCTTACCAGAGCAGCCTTTAA

Full Affymetrix probeset data:

Annotations for 1641488_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime