FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641489_at:

>probe:Drosophila_2:1641489_at:476:581; Interrogation_Position=250; Antisense; TGGCGGTCTTTCTGGTGCTGTTCGT
>probe:Drosophila_2:1641489_at:70:287; Interrogation_Position=261; Antisense; CTGGTGCTGTTCGTCTACTTGAAGA
>probe:Drosophila_2:1641489_at:136:601; Interrogation_Position=268; Antisense; TGTTCGTCTACTTGAAGACCCGCCC
>probe:Drosophila_2:1641489_at:597:297; Interrogation_Position=293; Antisense; CGCGGTCTTGGCCTAATGTAGTCAT
>probe:Drosophila_2:1641489_at:380:537; Interrogation_Position=296; Antisense; GGTCTTGGCCTAATGTAGTCATAAA
>probe:Drosophila_2:1641489_at:278:483; Interrogation_Position=323; Antisense; GTAGTTTATAGTCGTGGTCAGTGCA
>probe:Drosophila_2:1641489_at:578:537; Interrogation_Position=338; Antisense; GGTCAGTGCAATTGAATCGTTGTAA
>probe:Drosophila_2:1641489_at:668:39; Interrogation_Position=353; Antisense; ATCGTTGTAAAGACATATAGCCTTA
>probe:Drosophila_2:1641489_at:710:401; Interrogation_Position=364; Antisense; GACATATAGCCTTAATAGTACAATT
>probe:Drosophila_2:1641489_at:480:709; Interrogation_Position=387; Antisense; TTAAATCACAGTTCGTCCATCCAAA
>probe:Drosophila_2:1641489_at:197:485; Interrogation_Position=530; Antisense; GTAGTGTTGAAAACCGTCTAGCGCT
>probe:Drosophila_2:1641489_at:87:721; Interrogation_Position=536; Antisense; TTGAAAACCGTCTAGCGCTTTGGCG
>probe:Drosophila_2:1641489_at:66:293; Interrogation_Position=544; Antisense; CGTCTAGCGCTTTGGCGGTTGATTA
>probe:Drosophila_2:1641489_at:658:579; Interrogation_Position=556; Antisense; TGGCGGTTGATTAAAAAAGGGCACT

Paste this into a BLAST search page for me
TGGCGGTCTTTCTGGTGCTGTTCGTCTGGTGCTGTTCGTCTACTTGAAGATGTTCGTCTACTTGAAGACCCGCCCCGCGGTCTTGGCCTAATGTAGTCATGGTCTTGGCCTAATGTAGTCATAAAGTAGTTTATAGTCGTGGTCAGTGCAGGTCAGTGCAATTGAATCGTTGTAAATCGTTGTAAAGACATATAGCCTTAGACATATAGCCTTAATAGTACAATTTTAAATCACAGTTCGTCCATCCAAAGTAGTGTTGAAAACCGTCTAGCGCTTTGAAAACCGTCTAGCGCTTTGGCGCGTCTAGCGCTTTGGCGGTTGATTATGGCGGTTGATTAAAAAAGGGCACT

Full Affymetrix probeset data:

Annotations for 1641489_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720