FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641491_at:

>probe:Drosophila_2:1641491_at:657:43; Interrogation_Position=139; Antisense; ATCGCACAGTTCGAGGTCCCAGATG
>probe:Drosophila_2:1641491_at:671:79; Interrogation_Position=152; Antisense; AGGTCCCAGATGTACCCGAGGAGTA
>probe:Drosophila_2:1641491_at:306:339; Interrogation_Position=195; Antisense; GCTCATCATCAAACAGATTTCCCTC
>probe:Drosophila_2:1641491_at:689:373; Interrogation_Position=231; Antisense; GAAGACCGGCGAATTCAACGTTGTA
>probe:Drosophila_2:1641491_at:198:615; Interrogation_Position=299; Antisense; TGAAGATCCCCATTGCCGTGTTGAA
>probe:Drosophila_2:1641491_at:143:327; Interrogation_Position=329; Antisense; GCGAGACCCGTAGCTTAAGACCAAA
>probe:Drosophila_2:1641491_at:163:103; Interrogation_Position=346; Antisense; AGACCAAATGTCGAGTTCCCCAATG
>probe:Drosophila_2:1641491_at:491:511; Interrogation_Position=376; Antisense; GTGACCTTCAAACTGGTGCAGGGAA
>probe:Drosophila_2:1641491_at:559:519; Interrogation_Position=401; Antisense; GTGGACCCGTACACGTATGCGGCAA
>probe:Drosophila_2:1641491_at:33:147; Interrogation_Position=437; Antisense; ACTTTGGCGAGTTTGACGACGGTCA
>probe:Drosophila_2:1641491_at:364:377; Interrogation_Position=517; Antisense; GAAGCAGCTCCTCAGACGAACGGCA
>probe:Drosophila_2:1641491_at:272:407; Interrogation_Position=61; Antisense; GACTGTACATCTGTGTTCCAAGGCC
>probe:Drosophila_2:1641491_at:375:251; Interrogation_Position=79; Antisense; CAAGGCCTGCAAATGGAGTCCGAGT
>probe:Drosophila_2:1641491_at:80:505; Interrogation_Position=96; Antisense; GTCCGAGTCGTTTTATGGTGTCACA

Paste this into a BLAST search page for me
ATCGCACAGTTCGAGGTCCCAGATGAGGTCCCAGATGTACCCGAGGAGTAGCTCATCATCAAACAGATTTCCCTCGAAGACCGGCGAATTCAACGTTGTATGAAGATCCCCATTGCCGTGTTGAAGCGAGACCCGTAGCTTAAGACCAAAAGACCAAATGTCGAGTTCCCCAATGGTGACCTTCAAACTGGTGCAGGGAAGTGGACCCGTACACGTATGCGGCAAACTTTGGCGAGTTTGACGACGGTCAGAAGCAGCTCCTCAGACGAACGGCAGACTGTACATCTGTGTTCCAAGGCCCAAGGCCTGCAAATGGAGTCCGAGTGTCCGAGTCGTTTTATGGTGTCACA

Full Affymetrix probeset data:

Annotations for 1641491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720